I. Genetic Backgrounds: WT, exoU and exoUspcU

All transposon insertions were created in Pseudomonas aeruginosa strain PA14. The majority of the mutants were made in wild type PA14. However, several mutants were created in the exoU- strain exoUpsi3 (denoted exoU)(11). Also, several mutants were created in a strain of PA14 that carries a nonpolar deletion of exoU and the adjacent downstream spcU gene. A subset of these mutants were subjected to arbitrary PCR and sequencing to identify the MAR2xT7 insertion sites (See Table 1).

The oligonucleotide primers used to generate deletion mutations in the PA14 exoUspcU genes were designed based on DNA sequences from strain PA14:

The exoUspcU(#15) deletion was generated by replacing 4.29-kb of wild-type sequence with a 1.88-kb PCR-amplified fragment that contained a 2.41-kb deletion in the exoUspcU open reading frame (in the same operon). The PCR-amplified fragment containing the deletion was subcloned into the SacI and HindIII sites of pEX18Ap generating plasmid pEX18exoUspcU8. The resulting construct was used to introduce the deleted exoUspcU gene into the wild-type PA14 genome by homologous recombination resulting in the mutant exoUspcU15 (denoted exoUspcU).

II. Transposons: MAR2xT7 and TnPhoA

While the majority of mutants were created using MAR2xT7 (denoted MrT7), a small subset were created using the Tn5-based transposon, TnPhoA (denoted PhoA)(See Table 1) . PA14::PhoA mutants were subjected to transposon insertion site identification. Mutants from this subset of the PA14 transposon insertion mutant library have been available for request in the past.

III. MAR2xT7 Construction

The plasmid carrying the MAR2xT7 transposon, pMAR2xT7, was derived from the pMFLGM.GB plasmid (the gracious gift of Russel Vance and John Mekalanos) which was created by inserting the linker:
5'-acgcgtgaagttcctatactttctagagaataggaacttcTCAAGCCAGCAAAGTGCGATACactagtacgct agctaccatggcagCcgcgggaagttcctatactttctagagaataggaacttcacgcgt-3'
(which contains FRT sites and SpeI, NheI, NcoI and SacII restriction sites) into the MluI site in pFAC [Wong SM, 2000]. The Gentamycin resistance cassette from pBBR1MCS-5 [Wong SM, 2000] was excised with NcoI and SacII and cloned into the modified pFAC to create pMFLGM.GB. To create pMAR2xT7, the primers
5'-CATCGATCGTCTAGTAACAGGTTGGCTGATAAGTCCCCGGTCTCTAGACCCTATAGTGAGTCGTATTACGCGGCCGC CGCGGGGAC-3'
and
5'-GTCCCCGCGGCGGCCGCGTAATACGACTCACTATAGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACTAGA CGATCGATG-3'
were annealed, digested with PvuI, extended with Taq polymerase, digested with SacII and ligated to replace the SacII/PvuII fragment in pMFLGM.GB. The primers encode a T7 promoter and an adjacent inverted repeat sequence (IR). The sequence encoding a T7 promoter and its adjacent IR sequence from pMycoMar [Sassetti CM, 1999] was amplified using the following oligonucleotides: 5'-CATAGCTAGCCGCGGGACCGAGATAGGGTTGAGTG-3' and 5'-TCCCCCCGGGTCTGACGCTCAGTCGAACG-3' The NheI-digested PCR fragment was inserted into the NheI site of the modified pMFLGM.GB to create pMAR2xT7 which was propagated in the pir+ Escherichia coli strain MC4100. Proper construction was confirmed by sequencing.

I. Transposon Mutagenesis and Colony Selection

i. TnPhoA Matings

Saturated cultures of PA14 and E. coli carrying pRT733 were mixed in a 1:1 ratio, dropped on King's B media plates (2% w/v peptone, 6.57 mM K2HP04x3H2O, 6.08 mM MgSO4X7H2O, 1% v/v glycerol) [Jones DL, 1954] and incubated for 6 hours at 37°C. Multiple matings were collected, resuspended in 100 mM MgSO4, and plated onto Luria Broth (LB) agar containing 200µg/mL neomycin and 100µg/mL Irgasan. Colonies were picked with a Qbot into 250µL LB containing 200µg/mL kanamycin and 50µg/mL irgasan and grown at 37°C statically approximately 40 hours. 70µL of each culture was transferred robotically to plates for arbitrary PCR and sequencing. 60µL 60% glycerol was added to the remaining culture in the working plates before transfer to 384-well plates for long-term storage.

ii. MAR2xT7 Matings

Tripartite matings were performed using saturated cultures of PA14, MC4100 carrying pMAR2xT7 and E. coli carrying pRK2013. 1:2:2 mixtures of the cultures respectively, were dropped on Kings' B media plates and incubated at 37°C for 2 hours before collection and plating on Luria broth (LB) agar containing 15µg/mL gentamycin and 1µg/mL irgasan. Colonies were picked with a Qbot (Genetix, Hampshire, United Kingdom) and grown statically in 96-well "working" plates containing 280µL LB and 15µg/mL gentamycin for approximately 40 hours at 37°C. 70µL of each culture was transferred robotically to plates for arbitrary PCR and sequencing. 70µL 60% glycerol was added to the remaining culture in the working plates (for a final glycerol concentration of 15%) before transfer to 384-well plates for long-term storage.

II. Arbitrary PCR and Sequencing

i. First-Round Arbitrary PCR

70 μL culture transfered from original working culture plates to polypropylene plates were stored at -20°C. Plates were thawe, incubated at 99°C for 10 minutes to lyse the cells and spun at 3500 rpm for 5 minutes to pellet cell debris. 3 μL of lysate was used as template for the first round of arbitrary PCR (ARB 1). ARB1 PCR reaction mix included 1x Taq Buffer (Roche), 10% DMSO, 2.5 μM dNTPs, 1.25 U of Taq polymerase (Roche) and 1.0 ng/μL of each of primer. For MAR2xT7 mutants, the transponson-specific primer, PMFLGM.GB-3a, (5'-TACAGTTTACGAACCGAACAGGC-3') was used. For TnPhoA mutants, Tn5Ext (5'-GAACGTTACCATGTTAGGAGGTC-3') was used as the transposon-specific primer. We found that different arbitrary (ARB 1) primers were more effective at different times during the project. The ARB 1 primer with the highest success rate was ARB1D (5'-GGCCAGGCCTGCAGATGATGNNNNNNNNNNGTAT-3'). Plates were sealed with adhesive foil (Diversified Biotech Alum-1000). After initial denaturation at 95°C for 5 minutes, plates (Corning Incorporated Costar #6511) were cycled 30 times at 95°C for 30 seconds 47°C for 45 seconds and 72°C for 1 minute. Plates were incubated 5 minutes at 72°C to allow for extension of PCR products. PCR products were stored at 4°C.

ii. Second-Round Arbitrary PCR

5 μL ARB1 reaction was used as template for the ARB 2 PCR reaction. ARB 2 reaction mix included 1x Taq Buffer (Roche), 10% DMSO, 2.5 μM dNTPs, and 1 ng/μL of each the transposon specific primer and ARB2 primer. For MAR2xT7 mutants, the PMFLGM.GB-2a primer (5'-TGTCAACTGGGTTCGTGCCTTCATCCG-3') was used. For TnPhoA mutants, Tn5Int2 (5'-GGAGGTCACATGGAAGTCAGATCCTGG-3') was used as the transposon-specific primer. The ARB 2 primer, ARB2A (5'-GGCCAGGCCTGCAGATGATG-3') was used. Plates were sealed with adhesive foil. Reactions were cycled 40 times: 95°C for 30 seconds, 45°C for 30 seconds and 72°C for 1 minute with a 5 minute extension at 72°C. Plates were stored at 4°C.

iii. PCR Cleanup

5 μL ARB2 reaction was mixed with 2 μL EXOSAP-IT enzyme mix (USB #78205) in a new reaction plate (Abgene #AB-0800). Plates were sealed with adhesive foil and incubated according to the manufacturer's instructions.

iv. Sequencing Preparation

Sequencing primer was added directly to each PCR cleanup reaction for a final concentration of 5 ng/μL. For MAR2xT7 mutants, PMFLGM.GB-4a (5'-GACCGAGATAGGGTTGAGTG-3') was used as the sequencing primer. For TnPhoA mutants, the Tn5Int primer (CGGGAAAGGTTCCGTTCAGGACGC-3') was used.

III. PA14NR Set

i. Mutant Selection Criteria

Selection of mutants for the non-redundant set was automated by creating a set of priorities. Mutants were prioritized as follows.

1. The mutants of each individual gene were divided into two groups: those with BLAST bit scores >=80, and those with scores <80. Priority was given to those with blast scores above 80.
2. Both of these two groups were further subdivided by background and transposon, with priority given to PA14/MAR2xT7 over PA14/PhoA and PA14/PhoA over exoU/MAR2xT7 or exoU/spcU/MAR2xT7.
3. Each of these six groups were ordered by distance of the transposon insertion site from the start of the gene, with priority given to more 5' insertions.
4. Lastly, the mutants were ordered by BLAST bits score such that, if all other criteria are equal, the mutant with the higher BLAST score had priority. In cases where there was a mutant available in the PA14 background, but a more 5' mutant was available in either the exoU or exoU/spcU background, both mutants were included in the set.

ii. Colony Purification

Mutants were picked manually from frozen 96-well working plates on dry ice and streaked onto LB agar containing 15µg/mL gentamycin. Plates were incubated at 37°C for 14-16 hours, cooled to room temperature and stored at 4°C for no more than 8 days before picking. Colonies were examined under a dissecting scope. A single colony with a morphology representative of the majority of colonies for a given mutant was used to inoculate 600µL LB, 15µg/mL gentamycin in a 96-deep well Master block (USA Scientific). Small colony variants were avoided except in cases where non-variants were not available.

iii. Culture Conditions

Master deep well blocks were incubated in a HiGro (Genomic Solutions, Ann Arbor, MI) set to 37°C with O₂ injection for 2 seconds every 5 minutes of incubation for 14-16 hours to select against RSCV. Plates were set at room temperature for 0-6 hours before transferring culture to Storage plates.

iv. Biomek Transfer to Master plates

Culture transfer methods were performed using a Biomek FX (Beckman Coulter, Inc., Fullerton, CA). 200µL sterile 60% glycerol was transferred from a reservoir to each deep well Master block and mixed 3 times by pipeting up and down 200µL at a time. Tips were touched to the side of the wells to remove liquid clinging to the end of the tips and discarded. Fresh tips were used to transfer 40µL of the mixed cultures to each of 10 96-well Storage plates containing 160µL LB with 15µg/mL gentamycin and 15% glycerol. The Biomek FX was set to pipet up culture 11 mm from the top of the culture for each transfer to minimize the surface area of the transfer tip coated with culture. Master blocks and Storage plates were sealed (Alumina Seals, Diversified Biotech, Boston, MA) and stored and -80°C immediately after transfer.