Mutant Report for Mutant ID: 6330

Strain: PA14 Genetic Background: exU3 Transposon: MrT7 Library: PA14_exoUpsi3_Mar2xT7
Raw Sequence ID: 3067
Chromat Path: J:\exU3\MrT7\66v1\66v1_H06_h6_058.ab1 Last Transposon Base: 61 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
GTTCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGGCGCCGC
TGCGCGCAGCCGCCAACCCCTCTTCCCCGTCTCGGCACCAGGTCACCTCGAAACCGCTGCCATTGAGGTG
CTGGAACAGATGTGCGCCCAGTGTCGGATCGTCCTCGATGGCCAGCAGTCGGGGGTCGGGCGTCAGGGAT
GGGAACATGGCAGCCAAATAAGATTGATTAGCAATCGTGCCAGTATTCACGATCTTTCCGCTTCGTCGCA
AGCCGAATCCGCCGGGCTGCGCACATCGGTGCAGATTCCCCTTCCGCGACCCGCTATACCCCCCCCCCCG
TACTATCGACCGCGTGGCCAANNNNNNTNNNNNNNNGNNTCNNNGNNNGNNNNGNGNNNNNGGNTNTNNG
NTGTGTGGGNGNGTNGTGGTGGTTGTTGTGTTTGGCGGNGTGTGTTGGTGTTGGTTTTTGTGGGTGGTTG
TGGTGGGGTCGGGTGTTGGCTTGGCTTGCCCGGTTTTCGCGCGCGGCCGCTGTTGGTGTTCGCCTGGTCC
CCTCGTCGCCCCCTTCTGTGTTGTTTTGTCCCCGTGTTCTTCTCTTCCCTTTCCTGCTTTTTCCTTCGGC
CCTGTGCGCGTTGTCCTCCCCGTCCCCCCTCGTTCGCCTTCGCCCGTCCTTTCCCCGTTCTCTTTTTCCC
CCCGTTGGGTGCCCCCGCTTTTTTCCCTTCCCCCTTCTTGCCCCCCTCCTTTCCCTTTTCCCCTTCTTTC
CGCCCCTCCCTCCTTTCCCCGCCCCTCTTTTTTCGGTCCTTCGCGCTTTCTCCTCCTTCTCTTTCGTCCT
CCGCCTTCTCTTTTCTCTTTTCTTTTCTCCCTTTTTTTTTCGCN
Blast against PA14
Processed Seqquence ID: 1930
5' Trim Position: 1 3' Trim Position: 363
Processed Sequence:
(Transposon Sequence in Red)
TTCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGGCGCCGCT
GCGCGCAGCCGCCAACCCCTCTTCCCCGTCTCGGCACCAGGTCACCTCGAAACCGCTGCCATTGAGGTGC
TGGAACAGATGTGCGCCCAGTGTCGGATCGTCCTCGATGGCCAGCAGTCGGGGGTCGGGCGTCAGGGATG
GGAACATGGCAGCCAAATAAGATTGATTAGCAATCGTGCCAGTATTCACGATCTTTCCGCTTCGTCGCAA
GCCGAATCCGCCGGGCTGCGCACATCGGTGCAGATTCCCCTTCCGCGACCCGCTATACCCCCCCCCCCGT
ACTATCGACCGC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
7932 7932 7933 7933
PA14 BLAST Hit ID: 7932       Show Transposon Map
Identities: 276/276 (100.00%) BLAST Bit Score: 547.0 Percent of Processed Sequence That Aligns: 75.97%
Query Start: 60 Query End: 335 Subject Start: 4635462 Subject End: 4635737 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4635462 PA14_52250 -
Raw Sequence Start: 4635402 PA14_52250 -
Extrapolated Insert Location: 4635463 PA14_52250 -
Default Offset Location: 4635465 PA14_52250 -
PAO1 BLAST Hit ID: 7933       Show Transposon Map
Identities: 272/272 (100.00%) BLAST Bit Score: 539.0 Percent of Processed Sequence That Aligns: 74.86%
Query Start: 64 Query End: 335 Subject Start: 1016091 Subject End: 1015820 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1016091 PA0929 -
Raw Sequence Start: 1016155 PA0929 -
Extrapolated Insert Location: 1016094 PA0929 -
Default Offset Location: 1016092 PA0929 -
H PA14 Blast Hit H PAO1 Blast Hit