Mutant Report for Mutant ID: 52922

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 27467
Chromat Path: H:\Pa14\MrT7\552v1\552v1_C02_C2_008.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
TTTTNNNNNNNTTTTTNNNNTTTTTTNTTTTNTTTTNTTTNNNNNNNTNTNNNNTTNNNNNNGTGTTCAG
TTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGTCGGTGTGCGG
CGAATATTACCGGATGTGCCGGNGAAAGAAAGCCGTTCGGTGTCAAACCAATGACGCAATTGCCGGAGAT
GGAAGCTCTTTGCGTCTTGTCCTGTCTGGTTTTCTGGCTGAGCATGTAGGACGTTACTGACCTTTATCAG
GGGGCGGCATGATCCGGGAAATCCTCAAGATGGGTGACGAGCGCCTGTTGCGCATTGCGCAGCCGGTGCC
GTCCGAACTGCTCGGCAGCGAGGAGCTGCAACGGCTGATCGACGACATGTTCGAAACCATGCATCACCTC
ATCATCATCTGCAGGCCTGGCCATTTATTTTTTTTCTTATTAAAACCTTTAACCTTTTTACCCCTTCGCT
CTATCTCTCTACTAATTAACATCAATTTTTTAATAACACAAGCAAAAAATAGCTTTATATTTCTCCTATT
TTAACCCTTTCCCTTTACCGTTTATACTTTGATCTCCTTTTTATCTTTTTCCTTCTCCCCATTCTTTACA
CAAAATGAGACTTAATAAAAAAAAAAACACCCCCTACAACTCTACCACACTCTACTGATTTTTATAATAC
AATATATATAATATCTCTCTTTCTTTTCGATTTATGTATATTGCGCTCTCTCTCTTATTTTTTCTTCTTC
CACTTTTCCCCTTATTTTCTTCTATTCTCCCCTTATTGTTCATTTAATTTTTTTTGCATTACAAACTTCC
AGCTTTCACTTCTATATCTCCCCTCTCCTCTCTATCTCTTTCTATATCTCTCTTTATTTTATCCTTATAT
CTCTATTTAGACCGATGTGTGTTATCTAATGTTATTCTGACCAAATATTCTTCACAACTATTTTAATTTA
TATTAATTAACATATCCACATAATTATATACAACATCTAN
Blast against PA14
Processed Seqquence ID: 21021
5' Trim Position: 73 3' Trim Position: 419
Processed Sequence:
(Transposon Sequence in Red)
GTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGTCGGTGTGCGGCGA
ATATTACCGGATGTGCCGGNGAAAGAAAGCCGTTCGGTGTCAAACCAATGACGCAATTGCCGGAGATGGA
AGCTCTTTGCGTCTTGTCCTGTCTGGTTTTCTGGCTGAGCATGTAGGACGTTACTGACCTTTATCAGGGG
GCGGCATGATCCGGGAAATCCTCAAGATGGGTGACGAGCGCCTGTTGCGCATTGCGCAGCCGGTGCCGTC
CGAACTGCTCGGCAGCGAGGAGCTGCAACGGCTGATCGACGACATGTTCGAAACCATGCATCACCT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
94744 94744 94745 94745 94746 94746 94747 94747
PA14 BLAST Hit ID: 94744       Show Transposon Map
Identities: 290/291 (99.65%) BLAST Bit Score: 561.0 Percent of Processed Sequence That Aligns: 83.82%
Query Start: 54 Query End: 344 Subject Start: 4434810 Subject End: 4434521 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4434810
Raw Sequence Start: 4434936 PA14_49880 -
Extrapolated Insert Location:
Default Offset Location: 4434873 PA14_49880 -
PA14 BLAST Hit ID: 94745       Show Transposon Map
Identities: 28/28 (100.00%) BLAST Bit Score: 56.0 Percent of Processed Sequence That Aligns: 7.80%
Query Start: 311 Query End: 338 Subject Start: 21505 Subject End: 21478 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 21505 PA14_00200 +
Raw Sequence Start: 21888 PA14_00210 -
Extrapolated Insert Location:
Default Offset Location: 21825 PA14_00210 -
PAO1 BLAST Hit ID: 94746       Show Transposon Map
Identities: 283/291 (97.25%) BLAST Bit Score: 505.0 Percent of Processed Sequence That Aligns: 83.82%
Query Start: 54 Query End: 344 Subject Start: 1215123 Subject End: 1215412 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1215123
Raw Sequence Start: 1214997 PA1121 -
Extrapolated Insert Location:
Default Offset Location: 1215060 PA1121 -
PAO1 BLAST Hit ID: 94747       Show Transposon Map
Identities: 28/28 (100.00%) BLAST Bit Score: 56.0 Percent of Processed Sequence That Aligns: 7.80%
Query Start: 311 Query End: 338 Subject Start: 21484 Subject End: 21457 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 21484 PA0019 +
Raw Sequence Start: 21867 PA0020 -
Extrapolated Insert Location:
Default Offset Location: 21804 PA0020 -
H PA14 Blast Hit H PAO1 Blast Hit