Mutant Report for Mutant ID: 44121

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 32490
Chromat Path: H:\Pa14\MrT7\460v1\460v1_E09_E9_069.ab1 Last Transposon Base: 64 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
TGTCAGTTAGGAATCGATACGCTATAGTGTTCTAGAGTACCGGAGACTTATCAGCCAACCTGTTACAGTT
TACGAACCGAACAGGCATCTTCTGCGGGCCTGTCCACAAACTTATAAGGNTNGGTGGGGGNCTACGGGGG
CGTCTACAACGCCGTACCGCAAGGCCAAGTTCAACTTCACCGGGCCGGTGGTGCCGATTCTCAAGTGGCG
CGCCCTGGCCAATCGCTTCGCTGGAACACGCGGTACTCTCCTTCTCCCTGCTGCCGAGCGACAAGTTCTT
CGTTGCACCAGTCTGGGAGGAGCATCCGCGTCGTGTTCAAGGCCGACGGCACCACAGACATGTTGGGGAA
TCGCCAACCAAAACAACAAGAAGTAAAGCACCTTGATATATTTTGTCCGTCGGTTCTTTTTTTTTTTTTT
TGTTCGTTGTGGTGTGGCCTTTTTGCTTTTTCTTGATGGTTCTTCTTGTTGTTCTAGTTGTCTTTGTACT
CGTTATGTGTGCCTCTGCTAAATATTGTATTTTTCTTTTTTCTACATGACCTATGTGCGTGAGTGGGCTA
TCTGTACCTGTGTTAAAGGGGAGTAGAGAATCTGGCGGATACATTGTGAGTAATAAGTTGTTAGTGCCTT
TATTTTGTCGTTGTTGTTGTCTTTTTTCATCACGTTTCTTTCCTGTACGTTGTGTTTTCTCTCTATTTCT
ATTGCCATGTCTATTTTGATCATTATGACTAAATTACCCAGCAAGTGTGATTACGGTGTGACGCTGGCTT
TGACCCTTGGTTTCTTGTTTGTTGTGTTTGTTCTGTTTACCTCGTTTTATTTTCTTCTTTTTTCCCTTTC
TTTCTTCATTTCTCTCCAGCTCCCACATTATAATTATTTCTCGTACCCTCACTTACATTTATTCTGTTAT
CTTGTAGTGTATGTGCATGCGGCTCTCGTCTTCTGTTTGTTCGACTATTCCGCTTCGTCCGCACCT
Blast against PA14
Processed Seqquence ID: 25013
5' Trim Position: 39 3' Trim Position: 192
Processed Sequence:
(Transposon Sequence in Red)
CCGGAGACTTATCAGCCAACCTGTTACAGTTTACGAACCGAACAGGCATCTTCTGCGGGCCTGTCCACAA
ACTTATAAGGNTNGGTGGGGGNCTACGGGGGCGTCTACAACGCCGTACCGCAAGGCCAAGTTCAACTTCA
CCGGGCCGGTGGT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
108385 108385 108386 108386
PA14 BLAST Hit ID: 108385       Show Transposon Map
Identities: 71/77 (92.20%) BLAST Bit Score: 103.0 Percent of Processed Sequence That Aligns: 49.67%
Query Start: 77 Query End: 153 Subject Start: 4386690 Subject End: 4386765 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4386690 PA14_49360,PA14_49370* +,-
Raw Sequence Start: 4386575 PA14_49360,PA14_49370* +,-
Extrapolated Insert Location: 4386639 PA14_49360,PA14_49370* +,-
Default Offset Location: 4386638 PA14_49360,PA14_49370* +,-
PAO1 BLAST Hit ID: 108386       Show Transposon Map
Identities: 71/77 (92.20%) BLAST Bit Score: 103.0 Percent of Processed Sequence That Aligns: 49.67%
Query Start: 77 Query End: 153 Subject Start: 1262322 Subject End: 1262247 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1262322 PA1163 +
Raw Sequence Start: 1262437 PA1163 +
Extrapolated Insert Location: 1262373 PA1163 +
Default Offset Location: 1262374 PA1163 +
H PA14 Blast Hit H PAO1 Blast Hit