Mutant Report for Mutant ID: 28405

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 12181
Chromat Path: H:\Pa14\MrT7\296v1\296v1_H01_H1_015.ab1 Last Transposon Base: 36 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
GGGTCTTTACACCGGGGACTTATCAGCCAACCTGTTACGTATCGCCGTGGAACAACTCGAGGGCGCCCTG
GAGGTCTTGCATGAACGCCGTGTGTATCTTCTCGTCGACGAATACTTGCACACCGCATTTCCTGCCTGCG
TTGACACCCTGGTTCTGCTGGCGGTAGAGCTGGAAACCGTGGACTTTCTGCAACTGCTCCAGCATGGCGT
AGCTGTTGTCGGTGGAACCGTCGTCGACGATGATCACTTCGAAATTCGGGTAGTCCTGCTCGTAGATGCT
GCGCAGGGCTTCTTCCAGGTACTTTTCCGCGTTGAAGCATGGCGCTACGACGGATACCAGCGGGGCGTCC
GTCGTGCCTGAGTGCTTGCTGGAAGTGGCTTCTTCAAATCATGTGTCGTTCTTGGTACTCATCTTGCCTG
GTATCCGCTCTAGGGGGTCGTCGGTCATGAAATCCTTGCGATCGTTCCTGTCATTCGGTGCTCGGCCCGG
GTCTGTCGTCAACTCAGCGTTTCCATTCCGCTGTTCGGTCATTGGAATGGCTCTGGCACCAATGCCAGGA
AGGGCAGGTATTTAGACAGTTTACTCGTCTGTAAATATAGAGTTATCCATCTGGTCCTAATAAAACCCCC
GCCTTTTTCTTTTTAATCCTTTTGTGGGCTTGCGATTATTCAGTATGAGTCCGTCCTCGTTATTCCTTCC
CCGGTTTTCCTTCCTCCTTCTCTCTCTTTTTTATTCCGCTTTGTCATTCTTCTTGCCTCCGTTTTCTGCG
CGTGCCGCCAGTACGTCTTAATTACAGCACATCAAACGCACGTTATTATATTACAAACATACCGATATAT
TCCCCATATCTCCTATTTATTTTTATTACTCTGTTTTCT
Blast against PA14
Processed Seqquence ID: 8029
5' Trim Position: 2 3' Trim Position: 382
Processed Sequence:
(Transposon Sequence in Red)
GTCTTTACACCGGGGACTTATCAGCCAACCTGTTACGTATCGCCGTGGAACAACTCGAGGGCGCCCTGGA
GGTCTTGCATGAACGCCGTGTGTATCTTCTCGTCGACGAATACTTGCACACCGCATTTCCTGCCTGCGTT
GACACCCTGGTTCTGCTGGCGGTAGAGCTGGAAACCGTGGACTTTCTGCAACTGCTCCAGCATGGCGTAG
CTGTTGTCGGTGGAACCGTCGTCGACGATGATCACTTCGAAATTCGGGTAGTCCTGCTCGTAGATGCTGC
GCAGGGCTTCTTCCAGGTACTTTTCCGCGTTGAAGCATGGCGCTACGACGGATACCAGCGGGGCGTCCGT
CGTGCCTGAGTGCTTGCTGGAAGTGGCTTC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
35876 35876 35877 35877 35878 35878 35879 35879 35880 35880 35881 35881
PA14 BLAST Hit ID: 35876       Show Transposon Map
Identities: 244/247 (98.78%) BLAST Bit Score: 466.0 Percent of Processed Sequence That Aligns: 64.74%
Query Start: 134 Query End: 380 Subject Start: 4901444 Subject End: 4901198 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4901444 PA14_55180 -
Raw Sequence Start: 4901579 PA14_55180 -
Extrapolated Insert Location: 4901543 PA14_55180 -
Default Offset Location: 4901516 PA14_55180 -
PA14 BLAST Hit ID: 35877       Show Transposon Map
Identities: 67/77 (87.01%) BLAST Bit Score: 73.8 Percent of Processed Sequence That Aligns: 20.00%
Query Start: 37 Query End: 113 Subject Start: 6258031 Subject End: 6257955 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6258031 PA14_70160,PA14_70150* -,+
Raw Sequence Start: 6258069 PA14_70160,PA14_70150* -,+
Extrapolated Insert Location: 6258033 PA14_70160,PA14_70150* -,+
Default Offset Location: 6258006 PA14_70160,PA14_70150* -,+
PA14 BLAST Hit ID: 35878       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 6.05%
Query Start: 156 Query End: 179 Subject Start: 4552351 Subject End: 4552374 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4552351 PA14_51220 -
Raw Sequence Start: 4552194 PA14_51220 -
Extrapolated Insert Location: 4552230 PA14_51220 -
Default Offset Location: 4552257 PA14_51220 -
PAO1 BLAST Hit ID: 35879       Show Transposon Map
Identities: 244/247 (98.78%) BLAST Bit Score: 466.0 Percent of Processed Sequence That Aligns: 64.74%
Query Start: 134 Query End: 380 Subject Start: 778953 Subject End: 779199 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 778953 PA0705 -
Raw Sequence Start: 778818 PA0705 -
Extrapolated Insert Location: 778854 PA0705 -
Default Offset Location: 778881 PA0705 -
PAO1 BLAST Hit ID: 35880       Show Transposon Map
Identities: 66/77 (85.71%) BLAST Bit Score: 65.9 Percent of Processed Sequence That Aligns: 20.00%
Query Start: 37 Query End: 113 Subject Start: 5984783 Subject End: 5984707 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5984783 PA5313 -
Raw Sequence Start: 5984821 PA5313 -
Extrapolated Insert Location: 5984785 PA5313 -
Default Offset Location: 5984758 PA5313 -
PAO1 BLAST Hit ID: 35881       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 6.05%
Query Start: 156 Query End: 179 Subject Start: 1097580 Subject End: 1097557 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1097580 PA1014 -
Raw Sequence Start: 1097737 PA1014 -
Extrapolated Insert Location: 1097701 PA1014 -
Default Offset Location: 1097674 PA1014 -
H PA14 Blast Hit H PAO1 Blast Hit