BLASTN 2.2.26 [Sep-21-2011]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Database: pa14 
           1 sequences; 6,534,396 total letters



Query= (879 letters)

Distribution of 33 Blast Hits on the Query Sequence




                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

GCTS_68                                                           551   e-157 
>GCTS_68 
          Length = 6534396

 Score =  551 bits (278), Expect = e-157
 Identities = 357/378 (94%), Gaps = 4/378 (1%)
 Strand = Plus / Plus

                                                                         
Query: 136   ctgcgttgacaccctggttctgctggcggtagagctggaaaccgtggactttctgcaact 195
             ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 52463 ctgcgctgacgccctggttctgctggcggtagagctggaaaccgtggactttctgcaact 52522

                                                                         
Query: 196   gctccagcatggcgtagctgttgtcggtggaaccgtcgtcgacgatgatcacttcgaaat 255
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 52523 gctccagcatggcgtagctgttgtcggtggaaccgtcgtcgacgatgatcacttcgaaat 52582

                                                                         
Query: 256   tcgggtagtcctgctcgtagatgctgcgcagggcttcttccaggtacttttccgcgttga 315
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 52583 tcgggtagtcctgctcgtagatgctgcgcagggcttcttccaggtacttttccgcgttga 52642

                                                                         
Query: 316   agcatggcgctacgacggataccagcggggcgtccgtcgtgcctgagtgcttgctggaag 375
             |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 52643 agcagggcgctacgacggataccagcggggcgtccgtcgtgcctgagtgcttgctggaag 52702

                                                                         
Query: 376   tggcttcttcaaatcatgtgtcgttcttggtactcatcttgcctggtatccgctctaggg 435
             |||||||||| ||||||||||||||||||  |||| |||||||||||| |||||| ||||
Sbjct: 52703 tggcttcttc-aatcatgtgtcgttcttgtcactcgtcttgcctggtagccgctccaggg 52761

                                                                         
Query: 436   ggtcgtcggtcatgaaatccttgcgatcgttcctgtcattcggtgctcggcccgggtctg 495
             || ||||||||||||| ||| |||||||||||| | |  |||||||||||| |||| |||
Sbjct: 52762 ggccgtcggtcatgaagtcc-tgcgatcgttcc-ggcgatcggtgctcggcacggg-ctg 52818

                               
Query: 496   tcgtcaactcagcgtttc 513
             |||  ||| |||||||||
Sbjct: 52819 tcggaaacacagcgtttc 52836

 Score = 73.8 bits (37), Expect = 3e-13
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                           
Query: 39      gtatcgccgtggaacaactcgagggcgccctggaggtcttgcatgaacgccgtgtgtatc 98
               |||| ||||||||| ||||||| |||||||||  || |||||||||| || | ||| |||
Sbjct: 5521720 gtatagccgtggaagaactcgatggcgccctgcgggccttgcatgaaggcggcgtggatc 5521661

                                
Query: 99      ttctcgtcgacgaatac 115
               |||||||||||||||||
Sbjct: 5521660 ttctcgtcgacgaatac 5521644

 Score = 40.1 bits (20), Expect = 0.005
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 158    ctggcggtagagctggaaaccgtg 181
              |||||||||||||||||| |||||
Sbjct: 401556 ctggcggtagagctggaagccgtg 401533

 Score = 36.2 bits (18), Expect = 0.073
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 275     gatgctgcgcagggcttc 292
               ||||||||||||||||||
Sbjct: 5368430 gatgctgcgcagggcttc 5368447

 Score = 34.2 bits (17), Expect = 0.29
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 147     ccctggttctgctggcg 163
               |||||||||||||||||
Sbjct: 5757291 ccctggttctgctggcg 5757307

 Score = 34.2 bits (17), Expect = 0.29
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                                
Query: 474     ttcggtgctcggcccgg 490
               |||||||||||||||||
Sbjct: 6029233 ttcggtgctcggcccgg 6029217

 Score = 32.2 bits (16), Expect = 1.1
 Identities = 19/20 (95%)
 Strand = Plus / Plus

                                   
Query: 233     gtcgacgatgatcacttcga 252
               ||||||||||||||| ||||
Sbjct: 3448104 gtcgacgatgatcacgtcga 3448123

 Score = 32.2 bits (16), Expect = 1.1
 Identities = 19/20 (95%)
 Strand = Plus / Plus

                                   
Query: 184     ctttctgcaactgctccagc 203
               |||||| |||||||||||||
Sbjct: 4185254 ctttcttcaactgctccagc 4185273

 Score = 32.2 bits (16), Expect = 1.1
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 190     gcaactgctccagcat 205
               ||||||||||||||||
Sbjct: 4225700 gcaactgctccagcat 4225715

 Score = 32.2 bits (16), Expect = 1.1
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 231     tcgtcgacgatgatca 246
               ||||||||||||||||
Sbjct: 5223536 tcgtcgacgatgatca 5223521

 Score = 32.2 bits (16), Expect = 1.1
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 287     ggcttcttccaggtac 302
               ||||||||||||||||
Sbjct: 5424197 ggcttcttccaggtac 5424212

 Score = 32.2 bits (16), Expect = 1.1
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 188     ctgcaactgctccagc 203
               ||||||||||||||||
Sbjct: 5752170 ctgcaactgctccagc 5752185

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 190    gcaactgctccagca 204
              |||||||||||||||
Sbjct: 861933 gcaactgctccagca 861919

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 229    cgtcgtcgacgatga 243
              |||||||||||||||
Sbjct: 874865 cgtcgtcgacgatga 874851

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 39      gtatcgccgtggaac 53
               |||||||||||||||
Sbjct: 1311238 gtatcgccgtggaac 1311252

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 147     ccctggttctgctgg 161
               |||||||||||||||
Sbjct: 1741614 ccctggttctgctgg 1741600

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 190     gcaactgctccagca 204
               |||||||||||||||
Sbjct: 2910449 gcaactgctccagca 2910463

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 160     ggcggtagagctgga 174
               |||||||||||||||
Sbjct: 2988161 ggcggtagagctgga 2988175

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 231     tcgtcgacgatgatc 245
               |||||||||||||||
Sbjct: 3281549 tcgtcgacgatgatc 3281535

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 278     gctgcgcagggcttc 292
               |||||||||||||||
Sbjct: 4021526 gctgcgcagggcttc 4021512

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 505     cagcgtttccattcc 519
               |||||||||||||||
Sbjct: 4086964 cagcgtttccattcc 4086978

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 147     ccctggttctgctggcggt 165
               ||||||| |||||||||||
Sbjct: 4157281 ccctggtgctgctggcggt 4157263

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 57      tcgagggcgccctgg 71
               |||||||||||||||
Sbjct: 4163816 tcgagggcgccctgg 4163830

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 228     ccgtcgtcgacgatg 242
               |||||||||||||||
Sbjct: 4430275 ccgtcgtcgacgatg 4430289

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 701     ccggttttccttcct 715
               |||||||||||||||
Sbjct: 4679201 ccggttttccttcct 4679187

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 231     tcgtcgacgatgatc 245
               |||||||||||||||
Sbjct: 4866163 tcgtcgacgatgatc 4866177

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 147     ccctggttctgctgg 161
               |||||||||||||||
Sbjct: 5153275 ccctggttctgctgg 5153289

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 58      cgagggcgccctgga 72
               |||||||||||||||
Sbjct: 5375858 cgagggcgccctgga 5375872

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 238     cgatgatcacttcga 252
               |||||||||||||||
Sbjct: 5643189 cgatgatcacttcga 5643203

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 810     acgttattatattac 824
               |||||||||||||||
Sbjct: 5729081 acgttattatattac 5729067

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 229     cgtcgtcgacgatgatcac 247
               |||||||||||| ||||||
Sbjct: 5741344 cgtcgtcgacgaagatcac 5741362

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 156     tgctggcggtagagc 170
               |||||||||||||||
Sbjct: 6383823 tgctggcggtagagc 6383837

 Score = 30.2 bits (15), Expect = 4.5
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 58      cgagggcgccctgga 72
               |||||||||||||||
Sbjct: 6433126 cgagggcgccctgga 6433140
  Database: pa14
    Posted date:  Jan 15, 2004  3:01 PM
  Number of letters in database: 6,534,396
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4165
Number of Sequences: 1
Number of extensions: 4165
Number of successful extensions: 34
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 33
length of query: 879
length of database: 6,534,396
effective HSP length: 16
effective length of query: 863
effective length of database: 6,534,380
effective search space: 5639169940
effective search space used: 5639169940
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)