Mutant Report for Mutant ID: 57032

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 31577
Chromat Path: H:\Pa14\MrT7\595v1\595v1_A08_A8_055.ab1 Last Transposon Base: 59 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
CCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGTGCGCTGG
CCGAAGGAACCGGCGGTTCTGCAACTCTGCGTGGTCGGCCCGACCGAGTACGCCGACGGTCTGCTCCGCG
GCATGGTGCAGGCCAATGGCAGGCGCGTGCATGCGGAACGCCGCGCGGTGGACAACCCGGACCTCGGCAC
GCTCTGCAACGTGATCTACCTCGGAGTGGTCGACGAGCGCGAGCGCCAGCAGGTGTTCCACAGCCTGGCC
GGGCATCCGGTCCTGTCCATCAGCGAGCGTGGCACCGAATGCAGCGTCGGCAGCATGTTCTGCCTCAACG
TCGGCGGTCCGCGCATCACCTTCGAGGCCAATCTCGACTCCATCGCCCGCAGCGGCGTACGCGTGCACCC
GAGCGTATTGAAACTGGCAAGGCGGCAGGCCACTCCGTGATGAACCGTCGTCGTCGCTATACGGCCCCCA
ACCATCTCTGAAGGGGCTGGCCATNNNNNTNNNNNNNNGNNNNGNNNNNNNNNNNNNNNTNNNNNNNNNN
NNNNNNNGNNNNNCNNNNNNNNNTGNNNNNNNNGNNNNNCNNNNNNNNNNNNNNNNNNNNNNNGNTNGNC
NNNTNNNTTTTTTTTNTTNNTTTTTNTTTTTTTTTTTTCCCCGCCACGTGTCCCCTGTTCAATTAGTGGA
GCTGAGCGTCTGGCTGGTGTAACTTCCCGCCTCGCGGTTTCTCCAAACATATCCCGTTTCTGTTTGCGAT
GTTGTTGTTATATCATTATGACCTCTCTCTTTTTTTGACTCTTCAAGACTACAATGAGTTTAGTGAAACT
TAATCGTCTACGCTGCGATTCTATAAATATT
Blast against PA14
Processed Seqquence ID: 24290
5' Trim Position: 1 3' Trim Position: 489
Processed Sequence:
(Transposon Sequence in Red)
CGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGTGCGCTGGC
CGAAGGAACCGGCGGTTCTGCAACTCTGCGTGGTCGGCCCGACCGAGTACGCCGACGGTCTGCTCCGCGG
CATGGTGCAGGCCAATGGCAGGCGCGTGCATGCGGAACGCCGCGCGGTGGACAACCCGGACCTCGGCACG
CTCTGCAACGTGATCTACCTCGGAGTGGTCGACGAGCGCGAGCGCCAGCAGGTGTTCCACAGCCTGGCCG
GGCATCCGGTCCTGTCCATCAGCGAGCGTGGCACCGAATGCAGCGTCGGCAGCATGTTCTGCCTCAACGT
CGGCGGTCCGCGCATCACCTTCGAGGCCAATCTCGACTCCATCGCCCGCAGCGGCGTACGCGTGCACCCG
AGCGTATTGAAACTGGCAAGGCGGCAGGCCACTCCGTGATGAACCGTCGTCGTCGCTATACGGCCCCC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
105816 105816 105817 105817 105818 105818 105819 105819
PA14 BLAST Hit ID: 105816       Show Transposon Map
Identities: 426/426 (100.00%) BLAST Bit Score: 844.0 Percent of Processed Sequence That Aligns: 87.09%
Query Start: 58 Query End: 483 Subject Start: 4435030 Subject End: 4435455 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4435030 PA14_49880 +
Raw Sequence Start: 4434972 PA14_49880 +
Extrapolated Insert Location: 4435031 PA14_49880 +
Default Offset Location: 4435035 PA14_49880 +
PA14 BLAST Hit ID: 105817       Show Transposon Map
Identities: 25/26 (96.15%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 5.12%
Query Start: 236 Query End: 261 Subject Start: 2142157 Subject End: 2142182 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2142157 PA14_24500 +
Raw Sequence Start: 2141921 PA14_24500 +
Extrapolated Insert Location: 2141980 PA14_24500 +
Default Offset Location: 2141984 PA14_24500 +
PAO1 BLAST Hit ID: 105818       Show Transposon Map
Identities: 418/426 (98.12%) BLAST Bit Score: 781.0 Percent of Processed Sequence That Aligns: 87.09%
Query Start: 58 Query End: 483 Subject Start: 1214903 Subject End: 1214478 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1214903 PA1121 +
Raw Sequence Start: 1214961 PA1121 +
Extrapolated Insert Location: 1214902 PA1121 +
Default Offset Location: 1214898 PA1121 +
PAO1 BLAST Hit ID: 105819       Show Transposon Map
Identities: 25/26 (96.15%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 5.12%
Query Start: 236 Query End: 261 Subject Start: 3427201 Subject End: 3427176 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3427201 PA3062 +
Raw Sequence Start: 3427437 PA3062 +
Extrapolated Insert Location: 3427378 PA3062 +
Default Offset Location: 3427374 PA3062 +
H PA14 Blast Hit H PAO1 Blast Hit