Mutant Report for Mutant ID: 56207

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 30752
Chromat Path: H:\Pa14\MrT7\586v1\586v1_D11_D11_092.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
TTTTTTTTNTTTTTTTTTTTNTNTNTTTTTTTTTTTTTTNNNTTTTTCTTTNTTTTTNNNNTNNNTCNNC
CCNNNNNTTTGTTCAAGTTTGCGATACGAATAGAGCATCATCTGCTGGCGGTGCGGACAATTATCAGCCA
ACCTGTTACAAGACCTTCATGTACCCGCAGTCGATGTGGTATGACCTACGAGAAGTACATCCGCTAGGCC
GCCGGCCTGGGCCGCGCGCCGACCGAGGTCGATCCGGACAGCTACGACTGGATGAACCACCACTGCGACG
TGCTGGTGTTCGGTGCCGGTCCGTCCGGCTTGGTCGTCGCCCTCGACTCCGATCGAATCGGCGCGCGGGA
GCATTTTCGCCGACTAGCTGGACTAGTTCGGCGGCAGTCTGCTGGACACCCGCTAGATCCTCCTACTGCA
TGCCCGCCGCCCAGTTAGTCTCGGACTCTTTGTCCGAACTGCTAGGCCTGCCGTCAAGCATCCTGCTACC
GCGCCTCCCGGTTCACGGCATACCACGATTATACTTTCCTCACCTTCTTCTTATTCCCCACCGTCTTTTT
ATCCGACCCTCTAACTCCTCCTGTCATCGATCCTCGTTACGTCTTATGTTCTTTTCGCCTCATCAGATTT
GTTCTCTTTTCTTACCCTCATCCGTCTCCTGTTCCGCTTTTGTCTTCATTTTTCCCCCCCTTCCTCCTTT
CTTCCCACTCTTTCCTCTTGGCATTGCAACTCGTTTTTTTTTATTTTAGTTTGGGTCATACTCGTCTGCC
CCGCCCCGGTCTCGTCTGTTATTCATCTCTGTTTTTGTTCCATTCTTTGTCCTTTACGCTATCGCGCGAC
GCCCGCGTCGATTTTATACACTCTTGCCTCCGCTCAATCTACACTAGGCAGACTCTAAGTGATTACTATT
TCGCAAGCTCTAACTCTCTTGTCTTCATTACTATTTGTTATATTCACGTGTGATTTACCTCTTTATGGGA
ATGGTAGTTTGTTTTATCTCGTTCCTCCTTCTCGCGACTGCTGTCTTTCTCCTCTTC
Blast against PA14
Processed Seqquence ID: 23626
5' Trim Position: 125 3' Trim Position: 276
Processed Sequence:
(Transposon Sequence in Red)
GACAATTATCAGCCAACCTGTTACAAGACCTTCATGTACCCGCAGTCGATGTGGTATGACCTACGAGAAG
TACATCCGCTAGGCCGCCGGCCTGGGCCGCGCGCCGACCGAGGTCGATCCGGACAGCTACGACTGGATGA
ACCACCACTGC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
103666 103666 103667 103667
PA14 BLAST Hit ID: 103666       Show Transposon Map
Identities: 128/130 (98.46%) BLAST Bit Score: 234.0 Percent of Processed Sequence That Aligns: 85.43%
Query Start: 22 Query End: 151 Subject Start: 6370332 Subject End: 6370460 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6370332 PA14_71500 +
Raw Sequence Start: 6370186 PA14_71500 +
Extrapolated Insert Location:
Default Offset Location: 6370249 PA14_71500 +
PAO1 BLAST Hit ID: 103667       Show Transposon Map
Identities: 128/130 (98.46%) BLAST Bit Score: 234.0 Percent of Processed Sequence That Aligns: 85.43%
Query Start: 22 Query End: 151 Subject Start: 6097407 Subject End: 6097535 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6097407 PA5418 +
Raw Sequence Start: 6097261 PA5418 +
Extrapolated Insert Location:
Default Offset Location: 6097324 PA5418 +
H PA14 Blast Hit H PAO1 Blast Hit