Mutant Report for Mutant ID: 55451

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 29996
Chromat Path: H:\Pa14\MrT7\578v1\578v1_E11_E11_087.ab1 Last Transposon Base: 58 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
CGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGAGGGCACCC
ACGATGTCCACGCGCTGATCCTCGGCCGCGCGCAGACCGGCATCCAGGCATTCTTCTGAGCCACCGAGCA
ACACCCCGGCGCGCTTTTTCACGGTAGCGCGCCGGCCGCCGGGGAGACGGGCAAGGAACCCGTCTTCCCG
GCCATTTCCGTTTCCAGCCCCCAGCAGCGAGAACCGTCATGCCCGGCGCCCTTATCCTTAGCCGGGCTGT
CCACCTGTCCCGTGTCCTGGCCGGCCCTTGGGCCGGGCAGATTCTCGCCGACCTCGGCGCCGAGGTGATC
AAGATCGAGCGCCCCGGCAGCTGCGACACACACCCGCTCCTGGGGTCCGCCGTTCCTCAAGGATGCCGAA
GGCAATCGACTCCAGCGAGGCGGCCTTCTACCTGTCGGCCAACCGCCATAAGAAGTCGGTGACGGTTGAC
TTCACCCAACCGGAAGGATCACCCATCGTTCGCGAATTGGCGGCCACGACGACATCCTGGCTGAGAACTC
CAAGGTCGGCGGACTCAGGCCTATGGCCTCGACTATGAATCCTCTGATACAGTCTACCCGTAATCTTATC
TACTGTTCGATCACCGGGTTTCGCCAGTCTTGGCCCCTATGTCAAGCACGTCTTGTTTTTACCTTCATCA
TTCCCCGCCTTTGTGCATCTCTTTATTTTTTTCCTCCCTCTCCCGTCTCCATTTACTTTTCCCTGTTCCT
TTCTAAGTCCACTTTGCTTTTTTTTGCCTTTCCCCCATTTTACAAAACCTCTATACCTATCTCTTTCTCT
CGCTTCCATATCTTTTTATTTTTTTCCCCTCTTCTAACCTCATTCTTCCTCCTACCAACAACAA
Blast against PA14
Processed Seqquence ID: 23074
5' Trim Position: 1 3' Trim Position: 420
Processed Sequence:
(Transposon Sequence in Red)
GTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGAGGGCACCCA
CGATGTCCACGCGCTGATCCTCGGCCGCGCGCAGACCGGCATCCAGGCATTCTTCTGAGCCACCGAGCAA
CACCCCGGCGCGCTTTTTCACGGTAGCGCGCCGGCCGCCGGGGAGACGGGCAAGGAACCCGTCTTCCCGG
CCATTTCCGTTTCCAGCCCCCAGCAGCGAGAACCGTCATGCCCGGCGCCCTTATCCTTAGCCGGGCTGTC
CACCTGTCCCGTGTCCTGGCCGGCCCTTGGGCCGGGCAGATTCTCGCCGACCTCGGCGCCGAGGTGATCA
AGATCGAGCGCCCCGGCAGCTGCGACACACACCCGCTCCTGGGGTCCGCCGTTCCTCAAGGATGCCGAA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
102031 102031 102032 102032 102033 102033 102034 102034 102035 102035 102036 102036 102037 102037 102038 102038
PA14 BLAST Hit ID: 102031       Show Transposon Map
Identities: 349/363 (96.14%) BLAST Bit Score: 601.0 Percent of Processed Sequence That Aligns: 86.40%
Query Start: 57 Query End: 419 Subject Start: 516069 Subject End: 515708 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 516069 PA14_05830*,PA14_05840 -,+
Raw Sequence Start: 516126 PA14_05830*,PA14_05840 -,+
Extrapolated Insert Location: 516068 PA14_05830*,PA14_05840 -,+
Default Offset Location: 516063 PA14_05830*,PA14_05840 -,+
PA14 BLAST Hit ID: 102032       Show Transposon Map
Identities: 26/27 (96.29%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 6.21%
Query Start: 326 Query End: 352 Subject Start: 1531323 Subject End: 1531349 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1531323 PA14_17820 +
Raw Sequence Start: 1530997 PA14_17800*,PA14_17810 -,+
Extrapolated Insert Location: 1531055 PA14_17800*,PA14_17810 -,+
Default Offset Location: 1531060 PA14_17800*,PA14_17810 -,+
PA14 BLAST Hit ID: 102033       Show Transposon Map
Identities: 37/42 (88.09%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 9.79%
Query Start: 326 Query End: 367 Subject Start: 4687126 Subject End: 4687085 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4687126 PA14_52870,PA14_52860* +,-
Raw Sequence Start: 4687452 PA14_52880 +
Extrapolated Insert Location: 4687394 PA14_52880 +
Default Offset Location: 4687389 PA14_52880 +
PA14 BLAST Hit ID: 102034       Show Transposon Map
Identities: 25/26 (96.15%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 5.97%
Query Start: 333 Query End: 358 Subject Start: 1374170 Subject End: 1374145 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1374170 PA14_16120*,PA14_16130 -,+
Raw Sequence Start: 1374503
Extrapolated Insert Location: 1374445
Default Offset Location: 1374440
PAO1 BLAST Hit ID: 102035       Show Transposon Map
Identities: 347/363 (95.59%) BLAST Bit Score: 585.0 Percent of Processed Sequence That Aligns: 86.40%
Query Start: 57 Query End: 419 Subject Start: 502790 Subject End: 502429 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 502790 PA0447 +
Raw Sequence Start: 502847 PA0447 +
Extrapolated Insert Location: 502789 PA0447 +
Default Offset Location: 502784 PA0447 +
PAO1 BLAST Hit ID: 102036       Show Transposon Map
Identities: 26/27 (96.29%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 6.21%
Query Start: 326 Query End: 352 Subject Start: 4026685 Subject End: 4026659 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4026685 PA3592 +
Raw Sequence Start: 4027011 PA3593 +
Extrapolated Insert Location: 4026953 PA3593 +
Default Offset Location: 4026948 PA3593 +
PAO1 BLAST Hit ID: 102037       Show Transposon Map
Identities: 25/26 (96.15%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 5.97%
Query Start: 333 Query End: 358 Subject Start: 4183833 Subject End: 4183858 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4183833 PA3733 +
Raw Sequence Start: 4183500
Extrapolated Insert Location: 4183558
Default Offset Location: 4183563
PAO1 BLAST Hit ID: 102038       Show Transposon Map
Identities: 37/42 (88.09%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 9.79%
Query Start: 326 Query End: 367 Subject Start: 964465 Subject End: 964506 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 964465 PA0882 +
Raw Sequence Start: 964139 PA0881 +
Extrapolated Insert Location: 964197 PA0881 +
Default Offset Location: 964202 PA0881 +
H PA14 Blast Hit H PAO1 Blast Hit