Mutant Report for Mutant ID: 31778

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 16706
Chromat Path: H:\Pa14\MrT7\332v1\332v1_A02_A2_007.ab1 Last Transposon Base: 31 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TCGAGACCGGGGACTTATCAGCCAACCTGTTACTCGCGGAGGATGCGCAGCGCGCTGAACAGCAGCAGCG
CGAGGAACACCAGCAACATCGCCAAACCATAGGAAATACCCATCATCCACCTCATCTGTAGGCCTGGCCA
ACTTCCAGGAGCAGGCCCTTGCGCGCCAGCACCCAGACCGGCTGGCCCACCGCCAGCGGCCGCGCGGCGA
GCACCCGCCAGCGCTCGCCCTGGAGCAGCACCCAGCCTGCGCAGGGTTGTTCGGAATACACCGCCGCCAC
ATCATCTGGGGTGCTGACCATTCCGGAGGTGCCACTTACCACCGCTTGCCGGCGAGTACGCAGGGTCATG
CCCAACAGACCGACAATCAGCGCGTCTCTTTAAAATTGCAGGACTCTCCATCATGCCTGGTTGTCTGCCG
TATTCCAGGCTACATATATAATCGTATTCCGGTATCATCGCGCCGGACCCCCCTAACATAAAAAAATTCC
ACATCCACTCTTGATTCACCCCCACAAAACAGTGAGCGAGTAAACCGACATATCACCCAACAAGCATACT
ACACTCTGTACCAATAATAGTAACATAAACGATCCACTATACAGTGCGTTATAAACTAGACTACACAAAG
TGGAAACCTCGTACAAGAACCTACTTATTACAACACGTTATAATTACTCCTCGTTCCTATTATTCGCCCA
CCACACACACACATACTCAAGCATTAACTATGATTATTGATATCTCATCAAATCTTTACTACTATAATAC
TCATAATACTATATTAAACAGAATAGTATAACACATGTAATATATATATTATACGAATTTCTAATAGCAC
ACGTTTCATGTTCACCCCTAAGTATGAGCACCACTCCATTAACATGACATGGATCATATTGAATATCACA
GTGATACTGTTGTAAGACACTCACATAAATGCCATTATTCTAGCTGAACAACTTCATTATGAACATATCT
AGGACGCGTACAGTCAAGATTACAACTATGCTGTCATCCCTGAGGCTCACACACTCTTGAACACCAAAGT
ATAT
Blast against PA14
Processed Seqquence ID: 11821
5' Trim Position: 1 3' Trim Position: 278
Processed Sequence:
(Transposon Sequence in Red)
CGAGACCGGGGACTTATCAGCCAACCTGTTACTCGCGGAGGATGCGCAGCGCGCTGAACAGCAGCAGCGC
GAGGAACACCAGCAACATCGCCAAACCATAGGAAATACCCATCATCCACCTCATCTGTAGGCCTGGCCAA
CTTCCAGGAGCAGGCCCTTGCGCGCCAGCACCCAGACCGGCTGGCCCACCGCCAGCGGCCGCGCGGCGAG
CACCCGCCAGCGCTCGCCCTGGAGCAGCACCCAGCCTGCGCAGGGTTGTTCGGAATACACCGCCGCC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
53444 53444 53445 53445
PA14 BLAST Hit ID: 53444       Show Transposon Map
Identities: 238/248 (95.96%) BLAST Bit Score: 412.0 Percent of Processed Sequence That Aligns: 89.17%
Query Start: 30 Query End: 277 Subject Start: 522322 Subject End: 522075 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 522322 PA14_05890 -
Raw Sequence Start: 522352 PA14_05890 -
Extrapolated Insert Location: 522321 PA14_05890 -
Default Offset Location: 522289 PA14_05890 -
PAO1 BLAST Hit ID: 53445       Show Transposon Map
Identities: 237/248 (95.56%) BLAST Bit Score: 404.0 Percent of Processed Sequence That Aligns: 89.17%
Query Start: 30 Query End: 277 Subject Start: 509044 Subject End: 508797 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 509044 PA0452 -
Raw Sequence Start: 509074 PA0452 -
Extrapolated Insert Location: 509043 PA0452 -
Default Offset Location: 509011 PA0452 -
H PA14 Blast Hit H PAO1 Blast Hit