Mutant Report for Mutant ID: 28903

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 12679
Chromat Path: H:\Pa14\MrT7\302v1\302v1_A07_A7_053.ab1 Last Transposon Base: 60 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
ACGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATTCATGCAA
GCACTCCTCGGAACCCTCGCCTTGTCCCGGCGGGGGCAATGGAAAAGGATGGGGGGCAGCGATTGTCCGC
CTGCGGGCGCACGGCTTTCAGCCCGGCCATGGATATCCGTCAGGGCCTGCCCTGGCGGGAGTGGACCAGG
CCCTTGTTCTTTAGCCTGGAGAACACCGCCAGGGTGCAGTCGAGTAGCAGGTGGCCGTCGCGGTTGTAGC
ACTCGACGCGGGTGATCTTGCCCGAAGCGTCGCGAAGGAAGGCGATATGGCCGCCCTGGGCCAAGGCGTG
AAGCGTCCGTTGTTCCGGCTTGGAAACGTTCATGTCGGTAGAACCTGTAATCATCGGTGTGACAACGCGG
CAGCACTGCGCGAAAAGGCGTGTGCGAGCCATGGCGAAGGCAGATACCCGGCGACACCTCGTGCGGAATG
ACGAAGCGGCGGTTATCGGATGATTACTATCTCCAGCTACGATCCTCGCTATCGGAGGGCGCCCCGACCA
AGCGTGCTGCGATGCCGGAGTCTAGCCACACTGGCTCAAGGGACGGCGATAAAACGCCCGCTCTCCCTAT
TCTTCACGAGAGAACTTTGGCACTTTTGTTAAGGGGATTTCTCCTCTGCCTCGCCGGGGGACCGCCCTTT
TTCATTATACGGTCGGAAGAGGGTAGGTTATCCTTTGTTTCGCCCAGGGAGCTAACTCCTGTTCATGGGT
TCCTTTGTGAATTTCCCGCTCCCCCCCTCAAAGAAAACACACACCCCACATAGTGGTAACTAAGTGGGCC
GTGTGTCGAGGTGGTGCTTTGTCATAGGGGCGGCCTCCCTTGAACAAGCACCGTT
Blast against PA14
Processed Seqquence ID: 8472
5' Trim Position: 1 3' Trim Position: 462
Processed Sequence:
(Transposon Sequence in Red)
CGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATTCATGCAAG
CACTCCTCGGAACCCTCGCCTTGTCCCGGCGGGGGCAATGGAAAAGGATGGGGGGCAGCGATTGTCCGCC
TGCGGGCGCACGGCTTTCAGCCCGGCCATGGATATCCGTCAGGGCCTGCCCTGGCGGGAGTGGACCAGGC
CCTTGTTCTTTAGCCTGGAGAACACCGCCAGGGTGCAGTCGAGTAGCAGGTGGCCGTCGCGGTTGTAGCA
CTCGACGCGGGTGATCTTGCCCGAAGCGTCGCGAAGGAAGGCGATATGGCCGCCCTGGGCCAAGGCGTGA
AGCGTCCGTTGTTCCGGCTTGGAAACGTTCATGTCGGTAGAACCTGTAATCATCGGTGTGACAACGCGGC
AGCACTGCGCGAAAAGGCGTGTGCGAGCCATGGCGAAGGCA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
38082 38082 38083 38083
PA14 BLAST Hit ID: 38082       Show Transposon Map
Identities: 399/403 (99.00%) BLAST Bit Score: 767.0 Percent of Processed Sequence That Aligns: 87.20%
Query Start: 59 Query End: 461 Subject Start: 4896888 Subject End: 4896486 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4896888 PA14_55120* -
Raw Sequence Start: 4896947 PA14_55120* -
Extrapolated Insert Location: 4896887 PA14_55120* -
Default Offset Location: 4896884 PA14_55120* -
PAO1 BLAST Hit ID: 38083       Show Transposon Map
Identities: 392/404 (97.02%) BLAST Bit Score: 698.0 Percent of Processed Sequence That Aligns: 87.20%
Query Start: 59 Query End: 461 Subject Start: 783509 Subject End: 783912 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 783509 PA0711 -
Raw Sequence Start: 783450 PA0711 -
Extrapolated Insert Location: 783510 PA0711 -
Default Offset Location: 783513 PA0711 -
H PA14 Blast Hit H PAO1 Blast Hit