Mutant Report for Mutant ID: 25456

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 9232
Chromat Path: H:\Pa14\MrT7\266v1\266v1_B04_B4_031.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGGCCA
GCGCCAGTACGAGGTCACCTGCCGCCCGGCGCAGGGCGTGGCCGCCGCCGACCGCGCGGTGAACGTCCGC
GAGGTCACTCGCGAAGTGGCGCGGCAGATGGGCCTGCGTACCTGCTTCGCACCGCTGCCGGCACCCGGCG
CGGTGACCAACGGGGTACACCTGCACCTGAGCCTGCAACATGCCGACGGCAGCCCGCTGCTGTACGAGCC
CGGACGACCCAACGATCTCTCCGAACTCGGCGAGCACTGGGCCGCCGGCGTGCTCGCGCACCTGCCGGCG
CTGTGCGCGCTGACCGCGCATACCGCCGCCTCCTATCTGCTGCAGGCACGGCAACACTGGAGCGCCGCCT
ACGCCTGCCTGGGACTGCGCAACCGCGAAGCGGCGCTTCGCATCTGCCCCGTGGTGAGCGTCGGCCGGCA
ACCGCTTGGGAAGCAGTACAAACCCTGGAATCCCCGGCCGATGTACGCCACCCGCTGTCCCCACCCGGCA
ATGGCCGTGGTGCTGATCGCCGGTCTCCTGGGCTTCGAACGAAGCCTGGCTCCTGCGCAGCCCTGGCCCA
ATGTCAATCCCGCAAGGCCTCCTCTGAAAAAAAACACCAGGGCCCCTGGCCATCCAGGCCTTGCCCGGAG
ACCCCTTAGGGAATTCCTTCCACCTGTCCGTTAACGCCTGCAAAAAAGCTTCTTGCTCATAATTTCCAAA
ATCGTTTGTTTGACACCCCATCCCTTCCATGAAAAGGCCCCTACAGGGGCCATATAAGGGGGGGCTTTTA
CCACAAGAAAACCTGGTGCCCCCCACCAATTCCCGGGACTTTTTACGAAAACCCTCCGAATACTGGCAAC
Blast against PA14
Processed Seqquence ID: 5392
5' Trim Position: 5 3' Trim Position: 434
Processed Sequence:
(Transposon Sequence in Red)
AGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGGCCAGCGCC
AGTACGAGGTCACCTGCCGCCCGGCGCAGGGCGTGGCCGCCGCCGACCGCGCGGTGAACGTCCGCGAGGT
CACTCGCGAAGTGGCGCGGCAGATGGGCCTGCGTACCTGCTTCGCACCGCTGCCGGCACCCGGCGCGGTG
ACCAACGGGGTACACCTGCACCTGAGCCTGCAACATGCCGACGGCAGCCCGCTGCTGTACGAGCCCGGAC
GACCCAACGATCTCTCCGAACTCGGCGAGCACTGGGCCGCCGGCGTGCTCGCGCACCTGCCGGCGCTGTG
CGCGCTGACCGCGCATACCGCCGCCTCCTATCTGCTGCAGGCACGGCAACACTGGAGCGCCGCCTACGCC
TGCCTGGGA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
23557 23557 23558 23558
PA14 BLAST Hit ID: 23557       Show Transposon Map
Identities: 361/372 (97.04%) BLAST Bit Score: 650.0 Percent of Processed Sequence That Aligns: 86.48%
Query Start: 58 Query End: 429 Subject Start: 6473345 Subject End: 6473716 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6473345 PA14_72690,PA14_72680*,PA14_72670* +,-,+
Raw Sequence Start: 6473283 PA14_72690,PA14_72680*,PA14_72670* +,-,+
Extrapolated Insert Location: 6473346 PA14_72690,PA14_72680*,PA14_72670* +,-,+
Default Offset Location: 6473346 PA14_72690,PA14_72680*,PA14_72670* +,-,+
PAO1 BLAST Hit ID: 23558       Show Transposon Map
Identities: 359/372 (96.50%) BLAST Bit Score: 634.0 Percent of Processed Sequence That Aligns: 86.48%
Query Start: 58 Query End: 429 Subject Start: 6200106 Subject End: 6200477 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6200106 PA5508 +
Raw Sequence Start: 6200044 PA5508 +
Extrapolated Insert Location: 6200107 PA5508 +
Default Offset Location: 6200107 PA5508 +
H PA14 Blast Hit H PAO1 Blast Hit