Mutant Report for Mutant ID: 56708

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 31253
Chromat Path: H:\Pa14\MrT7\591v1\591v1_F08_F8_073.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 6
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACAAGTATCATATGCTGCAGACCGGGGCATTATTCACCAACCCGATACAAAGA
GCAATAACTGATCACTATCTCGCTGAGGGATGATCGGCCAGCCTGGCCAACGCAACCGGCCATCCGAGCC
GGATCATGGACGGTTCCTTCGCCAACCAGGTGCTGGCGCAGATCCACCTGTTCGAGCAGAAGTACGCCGA
CCTGCCGGCCGCCGAGAAGGCCAAGCGCCTGAGCGTCGAAGTGCTGCCGAAGAAGCTCGACGAGGAAGTG
GCCCTGGAGATGGTCAAGGGCTTCGGCGGCGTGGTCACCCAGCTGACCCCGAAACAGGCCGAGTACATCG
GCGTGAGCGTGGAAGGCCCGTTCAAGCCGGACACCTATCGCTACTAAGCGGACCACGGGGCAGGCGCCAT
GCGCCTGCACCGTTCGCATGAGCGCTCCCACGATGTCCACGCACCTCGCCGATCGCTACAACCAGGACTG
GTTGTTCGCCGTCCGCGCCCACCGGAACCAGACCCTCAGCGGCTCGCCGCTGCCTTATCTGGCGCACCTG
GGCATGGTCGCCCACGAGCTGCTGGCCGCCGATCCTTACTGTGCCATTCAACGGTTCGTGTAAACCCTTG
CATATCCCGTCCTTGCCCAACACCCCTGAAAAAAACCGGCGAACTCCCCCCAATGACTTTCTGCAACATA
TTCTGCGAGTTCCTCCGTGCCAGGCAGTAAGGTCCTTGAGCAAACTGGTAGTCGACCGGCCCCAAAGTTT
CCCTTCATTAACTATTTCCAGACCCTTGGTCGAGGGCCCCGCCCAAATCACCCTGGGTAATATTTTGGAA
TCATATACCTAACTGTGATTACACGGATCGATAAATTGTGAACCGGGGCAACATACTGCAAATAACTACC
TTGGATGGCTN
Blast against PA14
Processed Seqquence ID: 24026
5' Trim Position: 80 3' Trim Position: 460
Processed Sequence:
(Transposon Sequence in Red)
ATCACTATCTCGCTGAGGGATGATCGGCCAGCCTGGCCAACGCAACCGGCCATCCGAGCCGGATCATGGA
CGGTTCCTTCGCCAACCAGGTGCTGGCGCAGATCCACCTGTTCGAGCAGAAGTACGCCGACCTGCCGGCC
GCCGAGAAGGCCAAGCGCCTGAGCGTCGAAGTGCTGCCGAAGAAGCTCGACGAGGAAGTGGCCCTGGAGA
TGGTCAAGGGCTTCGGCGGCGTGGTCACCCAGCTGACCCCGAAACAGGCCGAGTACATCGGCGTGAGCGT
GGAAGGCCCGTTCAAGCCGGACACCTATCGCTACTAAGCGGACCACGGGGCAGGCGCCATGCGCCTGCAC
CGTTCGCATGAGCGCTCCCACGATGTCCAC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
105023 105023 105024 105024 105025 105025 105026 105026 105027 105027 105028 105028
PA14 BLAST Hit ID: 105023       Show Transposon Map
Identities: 347/349 (99.42%) BLAST Bit Score: 676.0 Percent of Processed Sequence That Aligns: 91.58%
Query Start: 32 Query End: 380 Subject Start: 497742 Subject End: 497394 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 497742 PA14_05610*,PA14_05620 -,+
Raw Sequence Start: 497853 PA14_05610*,PA14_05620 -,+
Extrapolated Insert Location: 497790 PA14_05610*,PA14_05620 -,+
Default Offset Location: 497790 PA14_05610*,PA14_05620 -,+
PA14 BLAST Hit ID: 105024       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 5.26%
Query Start: 213 Query End: 233 Subject Start: 5462619 Subject End: 5462599 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5462619 PA14_61200 +
Raw Sequence Start: 5462911 PA14_61200 +
Extrapolated Insert Location: 5462848 PA14_61200 +
Default Offset Location: 5462848 PA14_61200 +
PA14 BLAST Hit ID: 105025       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 5.00%
Query Start: 172 Query End: 191 Subject Start: 2408983 Subject End: 2408964 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2408983 PA14_27780 -
Raw Sequence Start: 2409234 PA14_27780 -
Extrapolated Insert Location: 2409171 PA14_27780 -
Default Offset Location: 2409171 PA14_27780 -
PAO1 BLAST Hit ID: 105026       Show Transposon Map
Identities: 346/349 (99.14%) BLAST Bit Score: 668.0 Percent of Processed Sequence That Aligns: 91.58%
Query Start: 32 Query End: 380 Subject Start: 482991 Subject End: 482643 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 482991 PA0432 +
Raw Sequence Start: 483102 PA0432 +
Extrapolated Insert Location: 483039 PA0432 +
Default Offset Location: 483039 PA0432 +
PAO1 BLAST Hit ID: 105027       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 5.26%
Query Start: 213 Query End: 233 Subject Start: 5190639 Subject End: 5190619 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5190639 PA4625 +
Raw Sequence Start: 5190931 PA4625 +
Extrapolated Insert Location: 5190868 PA4625 +
Default Offset Location: 5190868 PA4625 +
PAO1 BLAST Hit ID: 105028       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 5.00%
Query Start: 172 Query End: 191 Subject Start: 3165274 Subject End: 3165293 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3165274 PA2811 -
Raw Sequence Start: 3165023 PA2811 -
Extrapolated Insert Location: 3165086 PA2811 -
Default Offset Location: 3165086 PA2811 -
H PA14 Blast Hit H PAO1 Blast Hit