Mutant Report for Mutant ID: 56411

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 30956
Chromat Path: H:\Pa14\MrT7\588v1\588v1_E11_E11_085.ab1 Last Transposon Base: 61 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTATACGACTCGTATAGGATGCTAGAGACCGGAGACTTATCAGCCAACCTGTTAAGCGAGGC
CGGCGGAGAACCAGGTCAGGCCGATCACCAGGGTCAGCGCCGAGAGGCTGGTCCACAGCCACAGGGTCAG
GCCCAGGCCGATGGCCGGCACCAGCCCGTAGCGCAGCAGGTCGCGCGGGGCGCGGCGGCCGTCGAGCAGC
AGGTAGCTGCGGATCACCGCCAGGTTCACCGCGGAGAACGCCACCAGCGCGCCGAAGCTGATCATCGAGG
CCAGGGTGGTGAGGTCGATGACCACCGCCAGCAGGGAAATCACCGAGACCACCAGGATCGCGATCACTGG
CGTCTTGAAGCGCTCCGAGAGGCTGCCGAACACGCGCCGCGCCAGGATGCCGTCGCGCCCCATGCTGTAA
AGAATGCGCAACACCGAAGTCTTGCGGGCCCTTTGCCGAGCCGGGCGGCCCCGGGTAACTTAGGCGGGGG
TTAAAAAACTTGGGGAGGATTTTGCCCGCGGCCCCCAACATCCTTTCGTTGGCCGCCAACTGGGCGCCTG
GAAATCCCCCCCATCCATTATTTGGGGGGCTGGGCAANNNNTTTTTTTTTGTGGTTTTCTTGACACTCTT
TGTTTTGTTGTTTTTTATTTGTCTTTTTATTTCTCTAGCATATATTCCTACTATTTTTGTTTTACTTTTG
TATGATTATTTGTTACACGTTGAAGTTCGTTTCTTTTGGATTGTCTGGTTTATAGGTATTTTACACCCTC
CTATTTGGTTATTGAGTCGTTGCTGCCTTCCGTCTATGAGTGCTATGTAGTTTGTTCCTTCTTTTTTTTT
AGTCTCCTATTAATTTTA
Blast against PA14
Processed Seqquence ID: 23792
5' Trim Position: 41 3' Trim Position: 285
Processed Sequence:
(Transposon Sequence in Red)
GACTTATCAGCCAACCTGTTAAGCGAGGCCGGCGGAGAACCAGGTCAGGCCGATCACCAGGGTCAGCGCC
GAGAGGCTGGTCCACAGCCACAGGGTCAGGCCCAGGCCGATGGCCGGCACCAGCCCGTAGCGCAGCAGGT
CGCGCGGGGCGCGGCGGCCGTCGAGCAGCAGGTAGCTGCGGATCACCGCCAGGTTCACCGCGGAGAACGC
CACCAGCGCGCCGAAGCTGATCATCGAGGCCAGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
104183 104183 104184 104184 104185 104185
PA14 BLAST Hit ID: 104183       Show Transposon Map
Identities: 221/222 (99.54%) BLAST Bit Score: 432.0 Percent of Processed Sequence That Aligns: 90.57%
Query Start: 23 Query End: 244 Subject Start: 375703 Subject End: 375924 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 375703 PA14_04170*,PA14_04200*,PA14_04210 -,+,-
Raw Sequence Start: 375640 PA14_04170*,PA14_04200*,PA14_04210 -,+,-
Extrapolated Insert Location: 375701 PA14_04170*,PA14_04200*,PA14_04210 -,+,-
Default Offset Location: 375703 PA14_04170*,PA14_04200*,PA14_04210 -,+,-
PA14 BLAST Hit ID: 104184       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 8.20%
Query Start: 90 Query End: 110 Subject Start: 1190276 Subject End: 1190256 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1190276 PA14_13820*,PA14_13830 +,-
Raw Sequence Start: 1190406 PA14_13820* +
Extrapolated Insert Location: 1190345 PA14_13820*,PA14_13830 +,-
Default Offset Location: 1190343 PA14_13820*,PA14_13830 +,-
PAO1 BLAST Hit ID: 104185       Show Transposon Map
Identities: 221/222 (99.54%) BLAST Bit Score: 432.0 Percent of Processed Sequence That Aligns: 90.57%
Query Start: 23 Query End: 244 Subject Start: 361533 Subject End: 361754 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 361533 PA0322 -
Raw Sequence Start: 361470 PA0322 -
Extrapolated Insert Location: 361531 PA0322 -
Default Offset Location: 361533 PA0322 -
H PA14 Blast Hit H PAO1 Blast Hit