Mutant Report for Mutant ID: 56363

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 30908
Chromat Path: H:\Pa14\MrT7\588v1\588v1_A11_A11_083.ab1 Last Transposon Base: 65 Transposon Sequence
Match Quality: 2
Raw Sequence:
(Transposon Sequence in Red)
TGTCCGTTTGTATACGACTACACTATAGGATGTCTAGAGACCGGAAACTTATCAGCCAACCTGTTACAAC
GCGCCATCACACTGCAGACAGGGCCAGGCCTTCGTTTGCCAGCCTGGCCACCACGAACGCTCGCCTCTGG
TCATCGCCCACCGTGGCGCCAGCGGTTACGTACCGGAACACACCCTGGGCGCCTACGCCCTGGCGGTGAT
GATGGGCGCCGACTACGTCGAGCCGGACCTGGTGATGACCCGCGACGGCAAGCTGGTCGCCCGCCACGAC
AACGAGCTGGGCCTGACCACCGATGTCGCCCAGCACCCGGAATTCGCCGACCGCAAGCGCACGCAGAAAG
TCGACGGAGTGGAACTCACCGGCTGGTTCAGCGAAGACTTCACCCTCGCCGAACTGAAGACCCTGCGCGC
CATCGAGCGCATCCCCACGATCCGCCCGGCAATGCGCGCCTGGACGGCACCTTCGAGATCCCCACCCTGC
AGGAGATCATCGACCTGGTGAAAAGCCTGCAAATCAGCCAGCAACGCACCATCGGCCTGTACCCCCAGAT
CAAGCACGGTACCCCCTTTTTTTGGGTGGGGTGAAAATTATAATGCTCTTTGGTTATTTTTCTTCTTTTT
TCTTTCTCTTTTTTTTTTCTCTTTTTTTTTTTTTTCTCTTTTTTCTTTTCTTCAACTTTTGTTTTGTATT
CTGTTTTCCTTTACGGCCTTCTCTCCTCGTCATTCTCTCTGTCCTTGTTTCTTTTTTTCTTGCTTATTAT
TCTTCACACCTGCCTGTGTTTTGTATATTTATGTTCTCCTGTTTGTCTCTCTTTTTTTTTTTTTTGTTTT
GTGCGTTCTGTTTTTTTCTTTTCTCGTCATTACTTCTTTN
Blast against PA14
Processed Seqquence ID: 23746
5' Trim Position: 48 3' Trim Position: 446
Processed Sequence:
(Transposon Sequence in Red)
TTATCAGCCAACCTGTTACAACGCGCCATCACACTGCAGACAGGGCCAGGCCTTCGTTTGCCAGCCTGGC
CACCACGAACGCTCGCCTCTGGTCATCGCCCACCGTGGCGCCAGCGGTTACGTACCGGAACACACCCTGG
GCGCCTACGCCCTGGCGGTGATGATGGGCGCCGACTACGTCGAGCCGGACCTGGTGATGACCCGCGACGG
CAAGCTGGTCGCCCGCCACGACAACGAGCTGGGCCTGACCACCGATGTCGCCCAGCACCCGGAATTCGCC
GACCGCAAGCGCACGCAGAAAGTCGACGGAGTGGAACTCACCGGCTGGTTCAGCGAAGACTTCACCCTCG
CCGAACTGAAGACCCTGCGCGCCATCGAGCGCATCCCCACGATCCGCC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
104043 104043 104044 104044 104045 104045 104046 104046 104047 104047 104048 104048 104049 104049 104050 104050
PA14 BLAST Hit ID: 104043       Show Transposon Map
Identities: 351/358 (98.04%) BLAST Bit Score: 654.0 Percent of Processed Sequence That Aligns: 89.70%
Query Start: 41 Query End: 398 Subject Start: 404940 Subject End: 404583 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 404940 PA14_04540*,PA14_04550 +,+
Raw Sequence Start: 405028 PA14_04540*,PA14_04550 +,+
Extrapolated Insert Location: 404963 PA14_04540*,PA14_04550 +,+
Default Offset Location: 404965 PA14_04540*,PA14_04550 +,+
PA14 BLAST Hit ID: 104044       Show Transposon Map
Identities: 23/23 (100.00%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 5.53%
Query Start: 192 Query End: 214 Subject Start: 5953360 Subject End: 5953382 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5953360 PA14_66670 +
Raw Sequence Start: 5953121 PA14_66670 +
Extrapolated Insert Location: 5953186 PA14_66670 +
Default Offset Location: 5953184 PA14_66670 +
PA14 BLAST Hit ID: 104045       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 5.03%
Query Start: 202 Query End: 222 Subject Start: 3143444 Subject End: 3143424 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3143444 PA14_35350*,PA14_35360 -,+
Raw Sequence Start: 3143693 PA14_35350*,PA14_35360 -,+
Extrapolated Insert Location: 3143628 PA14_35350*,PA14_35360 -,+
Default Offset Location: 3143630 PA14_35350*,PA14_35360 -,+
PA14 BLAST Hit ID: 104046       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.77%
Query Start: 231 Query End: 250 Subject Start: 129244 Subject End: 129263 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 129244 PA14_01320 +
Raw Sequence Start: 128966 PA14_01320 +
Extrapolated Insert Location: 129031 PA14_01320 +
Default Offset Location: 129029 PA14_01320 +
PAO1 BLAST Hit ID: 104047       Show Transposon Map
Identities: 350/359 (97.49%) BLAST Bit Score: 624.0 Percent of Processed Sequence That Aligns: 89.70%
Query Start: 41 Query End: 398 Subject Start: 390767 Subject End: 390410 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 390767 PA0347 +
Raw Sequence Start: 390855 PA0347 +
Extrapolated Insert Location: 390790 PA0347 +
Default Offset Location: 390792 PA0347 +
PAO1 BLAST Hit ID: 104048       Show Transposon Map
Identities: 23/23 (100.00%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 5.53%
Query Start: 192 Query End: 214 Subject Start: 5681969 Subject End: 5681991 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5681969 PA5045 +
Raw Sequence Start: 5681730 PA5045 +
Extrapolated Insert Location: 5681795 PA5045 +
Default Offset Location: 5681793 PA5045 +
PAO1 BLAST Hit ID: 104049       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 5.03%
Query Start: 202 Query End: 222 Subject Start: 2489531 Subject End: 2489551 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2489531 PA2260 +
Raw Sequence Start: 2489282 PA2260 +
Extrapolated Insert Location: 2489347 PA2260 +
Default Offset Location: 2489345 PA2260 +
PAO1 BLAST Hit ID: 104050       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.77%
Query Start: 231 Query End: 250 Subject Start: 131329 Subject End: 131348 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 131329 PA0108 +
Raw Sequence Start: 131051 PA0108 +
Extrapolated Insert Location: 131116 PA0108 +
Default Offset Location: 131114 PA0108 +
H PA14 Blast Hit H PAO1 Blast Hit