Mutant Report for Mutant ID: 55924

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 30469
Chromat Path: H:\Pa14\MrT7\583v1\583v1_E04_E4_024.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
TGTTTTATTTGGAGGAGGGGAGGGGAAAAAAGAGGCAGAATAAAAATCCTNTTTTNNNNNNNTTGTTCAG
TTTGTATACGACTCACTATAGGGGTCTAGAGACGGGGACTTATCAGCCAACCTGTTACCTTGGCTATCTG
GCCGCGCGGACCCGCCGTATCGCCCTGGCCACCGGCAGCGCGGTGCTTGCCCTGCGCCAACCGGTCGACC
TGGCCAAGGCCGCGGCGAGCGTCGACCGGTTGTCCGGCGGACGCCTGGTGCTGGGCCTCGCCTCCGGCGA
CCGGCCGGTGGAGTTCCCCGCCTACGGGTTGGAGCATGCGCAGCGCGGCGAGCGGTTCGCCCAGGGCCTG
GACTACCTGCGCCAACTGCTGCACGGCTGCCGGCACGTCGCCTCGCCGCTCGGTACGCTGGACGACGCCG
AACTGTTGCCGCGTCCGCCGGCCGGCGCCATCCCGCTGGTCGTCACCGGCTCCGCGCGGCAGCAGGCGGA
CTGGCTGGCACGCCAAGCGGATGGCTGGCTGACCTATCCCGAGTCGACTGTCGAATCGTCCGAAACCACA
TCATCTGCAGGCCTGGGCCAATTAACCAAAATTACTTTATATAAATAGGCCCTGTGTCTCATCTCGCTCC
ACTACACTATGTCCCGTATCAACATTATGTTTTTTCTATTCTTAGATTTCGCTTCTGTGCACTCTACACG
CCCTCTCCCATTCATTACATAACCCCATAATTCTCCTCCCGTAAGTCGAAGAGCTCGTCGGAGGTTTACA
TTTAACTCCTTCTATCTATCATTATGTATAATATATTTATAACTGTCTGTCCCAAAGACACCGTGAGGAT
CAATCTGTCGCGTTTCTGCCGACCAGCCTATTAATATCACATCATGATTAATGGCGACACCTCATCATTC
ATCCTCAAAGAGGTACCTCTCCACACACTCGTAAAATTACTGATATGTAAACGTGAGATCAGTACAAACT
CACTCTCATTTTCTCCACTCGCCTCTGATTTTACNTTTCTCTCTCTCC
Blast against PA14
Processed Seqquence ID: 23396
5' Trim Position: 101 3' Trim Position: 484
Processed Sequence:
(Transposon Sequence in Red)
ACGGGGACTTATCAGCCAACCTGTTACCTTGGCTATCTGGCCGCGCGGACCCGCCGTATCGCCCTGGCCA
CCGGCAGCGCGGTGCTTGCCCTGCGCCAACCGGTCGACCTGGCCAAGGCCGCGGCGAGCGTCGACCGGTT
GTCCGGCGGACGCCTGGTGCTGGGCCTCGCCTCCGGCGACCGGCCGGTGGAGTTCCCCGCCTACGGGTTG
GAGCATGCGCAGCGCGGCGAGCGGTTCGCCCAGGGCCTGGACTACCTGCGCCAACTGCTGCACGGCTGCC
GGCACGTCGCCTCGCCGCTCGGTACGCTGGACGACGCCGAACTGTTGCCGCGTCCGCCGGCCGGCGCCAT
CCCGCTGGTCGTCACCGGCTCCGCGCGGCAGCA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
102931 102931 102932 102932
PA14 BLAST Hit ID: 102931       Show Transposon Map
Identities: 358/358 (100.00%) BLAST Bit Score: 710.0 Percent of Processed Sequence That Aligns: 93.21%
Query Start: 25 Query End: 382 Subject Start: 4361136 Subject End: 4360779 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4361136 PA14_49090 +
Raw Sequence Start: 4361261 PA14_49090 +
Extrapolated Insert Location:
Default Offset Location: 4361198 PA14_49090 +
PAO1 BLAST Hit ID: 102932       Show Transposon Map
Identities: 357/358 (99.72%) BLAST Bit Score: 702.0 Percent of Processed Sequence That Aligns: 93.21%
Query Start: 25 Query End: 382 Subject Start: 1287877 Subject End: 1288234 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1287877 PA1186 +
Raw Sequence Start: 1287752 PA1186 +
Extrapolated Insert Location:
Default Offset Location: 1287815 PA1186 +
H PA14 Blast Hit H PAO1 Blast Hit