Mutant Report for Mutant ID: 54793

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 29338
Chromat Path: H:\Pa14\MrT7\571v1\571v1_G01_G1_007.ab1 Last Transposon Base: 120 Transposon Sequence
Match Quality: 5
Raw Sequence:
(Transposon Sequence in Red)
NNGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGNNNTTTGCCCCACTTCNNNTTGTTCAGTT
TGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGGTGTCCGGCTTGA
ACGGGCCTTCCACGCTCACGCCGATGTACTCGGCCTGTTTCGGGGTCAGCTGGGTGACCACGCCGCCGAA
GCCCTTGACCATCTCCAGGGCCACTTCCTCGTCGAGCTTCTTCGGCAGCACTTCGACGCTCAGGCGCTTG
GTCTTCTCGGCGGCCGGTAGGTCGGCGTACTTCTGCTCGAACAGGTGGATCTGCGCCAGTACCTGGTTGG
CGAAGGAACCGTCCATGATCCGGCTCGGATGGCCGGTTGCGTTGCCCAGGTTGACCAGGGGGTCCTTCAG
GAGAGGATCAGGTAGTCGTCGGTTGGACACGTCCAAACTGTCCTTGCCGGGACGGGGGATCTAGCGTACC
TGCTGGCTGACCTCTTTCCCGGCACAGTTCTTGCGTATGAAGATGTTGTATGACGACGATTGACTAATGG
GCGGATGTTGCCGACCCCGGTTGGTTTCTTGAATGCCTTGTAAACTTCGGTATCCCCAACCTTCGACTTA
TCACTGGGAGTTCACAATTCTTGGGAACCGGCTCAGTATGGCCACAAGAAACCCTACTGTCCCAGCTGTT
AGTGTATTACAAGACTGTACCTGTGATATGAACAGTCGAACGGCAGTATGGTGGCTTATGTAGGAGGGAA
ATCGGTCAAAATTCCTTGGTAGCGCGTCAAATAATTGACCTGAGAAGACGCGGGGAATGTGTGGTAGATC
ATACAACAAGAATAGAGTGATCGTGACGGACGCACACAAATTGCCGCGCAAAGAAAACGTTATCAACATA
TATACACACTTACGTCGATTGAATAATTGATGGCAGAGACGAGTGTAGCAAAGCACGGTGGGAGAATAGA
GGCGGGGCTACACCCCTACGTGAGCGGTGCCGCGCGAGCCAAN
Blast against PA14
Processed Seqquence ID: 22579
5' Trim Position: 16 3' Trim Position: 383
Processed Sequence:
(Transposon Sequence in Red)
GGGGGGGGGGGGGGGGGGGGGGCGGNNNTTTGCCCCACTTCNNNTTGTTCAGTTTGTATACGACTCACTA
TAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGGTGTCCGGCTTGAACGGGCCTTCCACGCT
CACGCCGATGTACTCGGCCTGTTTCGGGGTCAGCTGGGTGACCACGCCGCCGAAGCCCTTGACCATCTCC
AGGGCCACTTCCTCGTCGAGCTTCTTCGGCAGCACTTCGACGCTCAGGCGCTTGGTCTTCTCGGCGGCCG
GTAGGTCGGCGTACTTCTGCTCGAACAGGTGGATCTGCGCCAGTACCTGGTTGGCGAAGGAACCGTCCAT
GATCCGGCTCGGATGGC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
100380 100380 100381 100381 100382 100382 100383 100383 100384 100384 100385 100385
PA14 BLAST Hit ID: 100380       Show Transposon Map
Identities: 256/259 (98.84%) BLAST Bit Score: 490.0 Percent of Processed Sequence That Aligns: 70.30%
Query Start: 109 Query End: 367 Subject Start: 497467 Subject End: 497725 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 497467 PA14_05610*,PA14_05620 +,-
Raw Sequence Start: 497343 PA14_05600 -
Extrapolated Insert Location: 497463 PA14_05610*,PA14_05620 +,-
Default Offset Location: 497406 PA14_05600 -
PA14 BLAST Hit ID: 100381       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 5.45%
Query Start: 183 Query End: 203 Subject Start: 5462599 Subject End: 5462619 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5462599 PA14_61200 -
Raw Sequence Start: 5462401 PA14_61200 -
Extrapolated Insert Location: 5462521 PA14_61200 -
Default Offset Location: 5462464 PA14_61200 -
PA14 BLAST Hit ID: 100382       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 5.18%
Query Start: 225 Query End: 244 Subject Start: 2408964 Subject End: 2408983 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2408964 PA14_27780 +
Raw Sequence Start: 2408724 PA14_27780 +
Extrapolated Insert Location: 2408844 PA14_27780 +
Default Offset Location: 2408787 PA14_27780 +
PAO1 BLAST Hit ID: 100383       Show Transposon Map
Identities: 256/259 (98.84%) BLAST Bit Score: 490.0 Percent of Processed Sequence That Aligns: 70.30%
Query Start: 109 Query End: 367 Subject Start: 482716 Subject End: 482974 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 482716 PA0432 -
Raw Sequence Start: 482592 PA0431 -
Extrapolated Insert Location: 482712 PA0432 -
Default Offset Location: 482655 PA0431 -
PAO1 BLAST Hit ID: 100384       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 5.45%
Query Start: 183 Query End: 203 Subject Start: 5190619 Subject End: 5190639 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5190619 PA4625 -
Raw Sequence Start: 5190421 PA4625 -
Extrapolated Insert Location: 5190541 PA4625 -
Default Offset Location: 5190484 PA4625 -
PAO1 BLAST Hit ID: 100385       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 5.18%
Query Start: 225 Query End: 244 Subject Start: 3165293 Subject End: 3165274 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3165293 PA2811 +
Raw Sequence Start: 3165533 PA2811 +
Extrapolated Insert Location: 3165413 PA2811 +
Default Offset Location: 3165470 PA2811 +
H PA14 Blast Hit H PAO1 Blast Hit