Mutant Report for Mutant ID: 54678

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 29223
Chromat Path: H:\Pa14\MrT7\570v1\570v1_E06_E6_051.ab1 Last Transposon Base: 60 Transposon Sequence
Match Quality: 4
Raw Sequence:
(Transposon Sequence in Red)
CGTTTCGAACCGAATAGGTATATGCTGCTGGAGTAGCGCAAACTTATCAGCCAACCTGTTAAAGGCCAGG
CGATGGAGAGCCACGAGTTCATTCCTTGAATTCAGAGAGGCGCGATACTGGCCCAGCGCATCATCTGCAG
GCCTGGCCATATTCCGATATCCGTCTTCCATGAGTCGGACAATCCGGGAGAAAGGCACAAGGCCATCTGG
GCGCGCCGAAAAACCTAACACAAACTTTTGTATTTATCCGTTAGATGCCACGCTTTCTCAACGAACTGCA
ACAAGACCCATCATCTTCAGCACTGACCACATAAAAAATAGATAACTGCGGCGCGGGGGGGGGAAGCTAC
CTCCAACGTTTTGTTAAGAATTTTCGGTATTTATTTTTTATATTTTATTTCATATACATAAATGCTTCAC
ATTTTCCCCCGCTTTTCCAACAATATATTTTCCATACTTATGACATTTCATACATTATTTCCCGCACCTC
TCTTTTTGAACACTCCTATTACTTGAGTTGGTTTTTATATGTCCCAGGTTTTTTGTCCCCGGGTAGGGGA
GATGGGGCTGAGCGTAGCATTTGTGTCGAGTGATATAAGATGCGAAAGGCGCGGTCGTGATCTTTTGTTT
ACCGTTATTTCGTATGACCTGTGCATAGTGCACCTGATAGGTTGTTTGTTGTTGTGATATCCGTGTGTAT
TAATTGTTTTCACACATAGAAACCACTTTTTCCTTGTTGTTTTTTTTTCTCCTATCGTTTATCTTTTATG
CCCATCTGACCAGTTATTCACCACTTTTCAGAATGTTGTTTCGCTAGAATTATTTAGCACGCCGCTTGCA
TTATTTGTGGATGTGCCTGTATTGTGTTTGATGCTCTTTGGTACCCCCAGGTAGGGAGTCGCTGTCGTAT
GTACCGCGATTTTTGCTTTCCCTGTGTTTAAACACTA
Blast against PA14
Processed Seqquence ID: 22488
5' Trim Position: 37 3' Trim Position: 209
Processed Sequence:
(Transposon Sequence in Red)
GCAAACTTATCAGCCAACCTGTTAAAGGCCAGGCGATGGAGAGCCACGAGTTCATTCCTTGAATTCAGAG
AGGCGCGATACTGGCCCAGCGCATCATCTGCAGGCCTGGCCATATTCCGATATCCGTCTTCCATGAGTCG
GACAATCCGGGAGAAAGGCACAAGGCCATCTG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
100100 100100 100101 100101 100102 100102 100103 100103
PA14 BLAST Hit ID: 100100       Show Transposon Map
Identities: 69/69 (100.00%) BLAST Bit Score: 137.0 Percent of Processed Sequence That Aligns: 39.53%
Query Start: 23 Query End: 91 Subject Start: 41157 Subject End: 41089 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 41157 PA14_00490 -
Raw Sequence Start: 41216 PA14_00490,PA14_00500* -,-
Extrapolated Insert Location: 41156 PA14_00490 -
Default Offset Location: 41153 PA14_00490 -
PA14 BLAST Hit ID: 100101       Show Transposon Map
Identities: 59/61 (96.72%) BLAST Bit Score: 105.0 Percent of Processed Sequence That Aligns: 34.88%
Query Start: 112 Query End: 172 Subject Start: 41068 Subject End: 41008 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 41068
Raw Sequence Start: 41216 PA14_00490,PA14_00500* -,-
Extrapolated Insert Location: 41156 PA14_00490 -
Default Offset Location: 41153 PA14_00490 -
PAO1 BLAST Hit ID: 100102       Show Transposon Map
Identities: 57/61 (93.44%) BLAST Bit Score: 89.7 Percent of Processed Sequence That Aligns: 34.88%
Query Start: 112 Query End: 172 Subject Start: 41047 Subject End: 40987 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 41047
Raw Sequence Start: 41195 PA0040 -
Extrapolated Insert Location: 41135 PA0040 -
Default Offset Location: 41132 PA0040 -
PAO1 BLAST Hit ID: 100103       Show Transposon Map
Identities: 64/70 (91.42%) BLAST Bit Score: 83.8 Percent of Processed Sequence That Aligns: 39.53%
Query Start: 23 Query End: 91 Subject Start: 41137 Subject End: 41068 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 41137 PA0040 -
Raw Sequence Start: 41196 PA0040 -
Extrapolated Insert Location: 41136 PA0040 -
Default Offset Location: 41133 PA0040 -
H PA14 Blast Hit H PAO1 Blast Hit