Mutant Report for Mutant ID: 54528

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 29073
Chromat Path: H:\Pa14\MrT7\568v1\568v1_H12_H12_102.ab1 Last Transposon Base: 64 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCTCC
GGCAGCGCCGCGCTGGTGACGTGCACGTTCATGCCAGCCATGAAGCAGCCGAACAGGCCGCCGGTGACGG
CGACCCAGGCACGCAGCGATACCTTGTCGTCACATCATCTGCAGGCCTGGCCATTCCGGTTCGCGAGTGT
CCACGGTGGCGATCACCGACATCCTGGGCAGCAGCCGGTCCCGCTCGGCGGCGTCGGTGTCCAGGCGGAT
ACGCACCGGGAACATCATCTGCAGGCCTGGCCATTTTTTTTGTGTTGTTTGTCTAGGGACACCCACGTGT
AGTTGTGGCGCGTTGGTTGTGTTAATATGAGACATACGGGTGGTTTTCGATAGTGTGGTGGGTTGTGTTG
GATTCCCATGCATGTGCGGTTGTGGTGTCGGTATGTTTTCTTTGGAATGATATTTTCGTGCTTAAGTAAT
GTTATAAGTGTTATGCTGTTTTTTTTAGTAATAAGTCTCGTTTTTTTAATTCATGCTGGGGGGTGATCTG
TATGGTGATGATAGAGATGTTGCGTCTTATTATACGACCATTGATGGGCGTGATAAGTGCCTTTGATATT
ATGGCGGTGTGAGTGTGGGACGGTAGTGAGACGGGTGATCCAAGGTGTTAGGTATGTCTCTGCTAGTCGT
TGTGGCCGGTTCTATATTTCATTCTTGTTATAAGCTGCTGTGAACGTAGTGCTAGTGTTCTGTTTAATAT
AGACTGTAGTCGTTTTAATGTACTTGCTATCTTATTGTTGGATAATATCTCGCCTGTTTATCTTATATGC
TTGTCGTCGTCTTTTGCATCCTCCCACGGTTGGGTGTGTGTGAGAGTCTAGCGGGCGTGTGTGTTTCATG
GTTATCGTTCGGTGAGTGCGTAGTTGTTGTGTTTAGATATTTAGCATGAGAATAGAGGTGTCGGTGTGGT
TGGGGGTG
Blast against PA14
Processed Seqquence ID: 22378
5' Trim Position: 3 3' Trim Position: 312
Processed Sequence:
(Transposon Sequence in Red)
TCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCTCCGGC
AGCGCCGCGCTGGTGACGTGCACGTTCATGCCAGCCATGAAGCAGCCGAACAGGCCGCCGGTGACGGCGA
CCCAGGCACGCAGCGATACCTTGTCGTCACATCATCTGCAGGCCTGGCCATTCCGGTTCGCGAGTGTCCA
CGGTGGCGATCACCGACATCCTGGGCAGCAGCCGGTCCCGCTCGGCGGCGTCGGTGTCCAGGCGGATACG
CACCGGGAACATCATCTGCAGGCCTGGCC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
99778 99778 99779 99779 99780 99780 99781 99781
PA14 BLAST Hit ID: 99778       Show Transposon Map
Identities: 109/109 (100.00%) BLAST Bit Score: 216.0 Percent of Processed Sequence That Aligns: 34.95%
Query Start: 61 Query End: 169 Subject Start: 4296771 Subject End: 4296663 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4296771 PA14_48290*,PA14_48300 +,-
Raw Sequence Start: 4296834 PA14_48290*,PA14_48300 +,-
Extrapolated Insert Location: 4296770 PA14_48290*,PA14_48300 +,-
Default Offset Location: 4296771 PA14_48290*,PA14_48300 +,-
PA14 BLAST Hit ID: 99779       Show Transposon Map
Identities: 95/98 (96.93%) BLAST Bit Score: 170.0 Percent of Processed Sequence That Aligns: 31.39%
Query Start: 192 Query End: 289 Subject Start: 4296640 Subject End: 4296543 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4296640 PA14_48260*,PA14_48280,PA14_48270*,PA14_48290* -,-,+,+
Raw Sequence Start: 4296834 PA14_48290*,PA14_48300 +,-
Extrapolated Insert Location: 4296770 PA14_48290*,PA14_48300 +,-
Default Offset Location: 4296771 PA14_48290*,PA14_48300 +,-
PAO1 BLAST Hit ID: 99780       Show Transposon Map
Identities: 108/109 (99.08%) BLAST Bit Score: 208.0 Percent of Processed Sequence That Aligns: 34.95%
Query Start: 61 Query End: 169 Subject Start: 1337825 Subject End: 1337933 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1337825 PA1236 -
Raw Sequence Start: 1337762 PA1236 -
Extrapolated Insert Location: 1337826 PA1236 -
Default Offset Location: 1337825 PA1236 -
PAO1 BLAST Hit ID: 99781       Show Transposon Map
Identities: 92/98 (93.87%) BLAST Bit Score: 147.0 Percent of Processed Sequence That Aligns: 31.39%
Query Start: 192 Query End: 289 Subject Start: 1337956 Subject End: 1338053 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1337956 PA1237 -
Raw Sequence Start: 1337762 PA1236 -
Extrapolated Insert Location: 1337826 PA1236 -
Default Offset Location: 1337825 PA1236 -
H PA14 Blast Hit H PAO1 Blast Hit