Mutant Report for Mutant ID: 5304

Strain: PA14 Genetic Background: exU3 Transposon: MrT7 Library: PA14_exoUpsi3_Mar2xT7
Raw Sequence ID: 2041
Chromat Path: J:\exU3\MrT7\56v1\56v1_B12_b12_095.ab1 Last Transposon Base: 29 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
GTGACCGGGGACTTATCAGCCAACCTGTTACGCCGTGCCGCTGCTGGATACCCCGCAGACCGTACTAGTG
GAGGCGCGGCCAGTAATCCAGGAGCAGAACGCCCTGAGCCTGCGCCAGGTGCTGTCCAACGTCTCCGGCA
TCACCTTCAACGCCGGCTAAGGCGGCGGCGGTTCCGGCGACAGCATCAACATCCGCGGCTTCAGCGCCAA
CGCCAACATGCAGGTGGACGGGCTGCGCGACAGCGCCCAGACCAGCCGCAGCGACCTGTTCAACCTGGAG
GCGGTGGAAGTGATCAAGGGACCGAACTCGGCGTTCGGCGGCGCCGGCACCAGCGGCGGCAGCATCAACA
TGGTCAGGAAGCAGACCAAGGTCGAAGCCTTCACCCACCTGGGCGCCGGGCTGGGCACGGACCGCTACCG
GCGCCTGACCCTGGACACCAACCAGCCGCTGGAAGGGCTCGGCGAGTCGACCGTCTTCCGCCTCAACCTC
ATGGACCACCACAACGACGTCTCCTGGCGCGAACAGATCCACAAACAGAGCTGGGGCATCCGCGCATCCC
TGACCCTCAGCCTGGACTCCCGACCCGCTTGACCCTAGCTACTTCCACCAACGCGATTACAGCCCTTCCG
ACTATACCCGCGCCTCGAGACTAGCCAAAACGGTAGCCAATGCCAATACCCTACTGACCGCCCACTCGCC
CCTTATTAAGACTCGACCACTTTCTCCCTCACTACCTCCCATTCTCCCACACACACACTATACCACCCTA
CACCAACCCACCCACTTTGTTGAAATCCATCCGCTCTCTGCTTTACAACGACACTTCGGTGGTCCCTATC
ACGTGGCCACCCCGTACCCAGCTATACGCCATACTACATCCGCCTGA
Blast against PA14
Processed Seqquence ID: 1190
5' Trim Position: 1 3' Trim Position: 490
Processed Sequence:
(Transposon Sequence in Red)
TGACCGGGGACTTATCAGCCAACCTGTTACGCCGTGCCGCTGCTGGATACCCCGCAGACCGTACTAGTGG
AGGCGCGGCCAGTAATCCAGGAGCAGAACGCCCTGAGCCTGCGCCAGGTGCTGTCCAACGTCTCCGGCAT
CACCTTCAACGCCGGCTAAGGCGGCGGCGGTTCCGGCGACAGCATCAACATCCGCGGCTTCAGCGCCAAC
GCCAACATGCAGGTGGACGGGCTGCGCGACAGCGCCCAGACCAGCCGCAGCGACCTGTTCAACCTGGAGG
CGGTGGAAGTGATCAAGGGACCGAACTCGGCGTTCGGCGGCGCCGGCACCAGCGGCGGCAGCATCAACAT
GGTCAGGAAGCAGACCAAGGTCGAAGCCTTCACCCACCTGGGCGCCGGGCTGGGCACGGACCGCTACCGG
CGCCTGACCCTGGACACCAACCAGCCGCTGGAAGGGCTCGGCGAGTCGACCGTCTTCCGCCTCAACCTC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
4885 4885 4886 4886 4887 4887 4888 4888 4889 4889
PA14 BLAST Hit ID: 4885       Show Transposon Map
Identities: 445/462 (96.32%) BLAST Bit Score: 781.0 Percent of Processed Sequence That Aligns: 94.27%
Query Start: 28 Query End: 489 Subject Start: 4201272 Subject End: 4200811 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4201272 PA14_47140 +
Raw Sequence Start: 4201300 PA14_47140 +
Extrapolated Insert Location: 4201271 PA14_47140 +
Default Offset Location: 4201237 PA14_47140 +
PA14 BLAST Hit ID: 4886       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.70%
Query Start: 283 Query End: 306 Subject Start: 3548790 Subject End: 3548813 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3548790 PA14_39820 +
Raw Sequence Start: 3548507 PA14_39820 +
Extrapolated Insert Location: 3548536 PA14_39820 +
Default Offset Location: 3548570 PA14_39820 +
PAO1 BLAST Hit ID: 4887       Show Transposon Map
Identities: 396/405 (97.77%) BLAST Bit Score: 731.0 Percent of Processed Sequence That Aligns: 82.62%
Query Start: 85 Query End: 489 Subject Start: 1433418 Subject End: 1433822 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1433418 PA1322 +
Raw Sequence Start: 1433333 PA1322 +
Extrapolated Insert Location: 1433362 PA1322 +
Default Offset Location: 1433396 PA1322 +
PAO1 BLAST Hit ID: 4888       Show Transposon Map
Identities: 35/35 (100.00%) BLAST Bit Score: 69.9 Percent of Processed Sequence That Aligns: 6.95%
Query Start: 28 Query End: 62 Subject Start: 1433361 Subject End: 1433395 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1433361 PA1322 +
Raw Sequence Start: 1433333 PA1322 +
Extrapolated Insert Location: 1433362 PA1322 +
Default Offset Location: 1433396 PA1322 +
PAO1 BLAST Hit ID: 4889       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.70%
Query Start: 283 Query End: 306 Subject Start: 2083541 Subject End: 2083518 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2083541 PA1910 +
Raw Sequence Start: 2083824 PA1910 +
Extrapolated Insert Location: 2083795 PA1910 +
Default Offset Location: 2083761 PA1910 +
H PA14 Blast Hit H PAO1 Blast Hit