Mutant Report for Mutant ID: 48613

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 36982
Chromat Path: H:\Pa14\MrT7\507v1\507v1_D01_D1_011.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
ACCCTTCACAACAAAGTATAACGTTTCTCCTCCTATAATTTCATTACCTTAAAATTTNNNNTNNCTGTTC
AGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGCGGCACCGA
CCTGCCGGTGATGGTCTACAACAACCCGCCGATCTACCGGAACGATGTCACCCCGGACATCCTGGTTTCC
CTGGCCGACTGCGACATCATCTGCTGGGCTGGCCAGCACAGCGGCGCACAGCAGTGGGTTCATCGTCGTA
TACCCCCCCTCTCCCCTGTGCCGCGTTTGGCCATCCCGTATTTTTACCTCCGCAGCTCCCGGTTATTATA
AGATTTATTTTCCTTCTCCCCTCTTCGTCCCCCCCCCCCTCCTTATTTTTCTTTTTTCCCGTGTGGTGTG
GTCTCGTCGCCCTTCTTTCCTGGTGGCGTTGTTTTTTTGTCATATTTTTTTTGTTGTTTTTATGTGTTTT
TTGTTGTGTCTCATTTTTTCGCCCGGCCGCTTTTGGATTTTTCCATGTCTCCTTTTTCCTGTGTATTCTA
TCCATGATGTCCATATATAAATTACCCACAATATTTTAAATACACTCCCCCTACTTTTCCCTGTTTTTCA
CTTTCCCCGTGTTTTTTTGTGTTCTATCCCACTCTTTGTCTGTTTGGTCTCTTTTTTTCTTCTTTCACCT
CCTCCTTTCCCTCCCCCTCCATTCTTTTTCTATCCTCCCCTTTCCCCCCCTTTCCCCCCCTCTTTTCCCT
CTCTCCCCGCTTTGTGCCTCCCACGACCCCCTTTTTTTCCGCCGGCCGCTCTTACTTTCCTGTGGTCCTG
TCGCTTTCTCTCGTCTTCGTGCGCTTCTTCCTTCGCTGTCGCCCCTTCTCTCTGTTTTTCCCTCGTTCCA
CCCCTTTCTCTCCCTTTTTTGCTCTTCCTCGCGCTTTTATTCGCCCGATTCTCTCTTCCCTCCTTGTGTC
GTACACCCCGCGTCAGTGTGTCACCCTCCCATCGGTTGGTCCCACACGTTTGGCCTCTCAACCAATCGTA
TTACTCNTCTGCCGTC
Blast against PA14
Processed Seqquence ID: 28242
5' Trim Position: 65 3' Trim Position: 242
Processed Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGCGGC
ACCGACCTGCCGGTGATGGTCTACAACAACCCGCCGATCTACCGGAACGATGTCACCCCGGACATCCTGG
TTTCCCTGGCCGACTGCGACATCATCTGCTGGGCTGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
119825 119825 119826 119826 119827 119827 119828 119828
PA14 BLAST Hit ID: 119825       Show Transposon Map
Identities: 96/96 (100.00%) BLAST Bit Score: 190.0 Percent of Processed Sequence That Aligns: 53.67%
Query Start: 64 Query End: 159 Subject Start: 4271690 Subject End: 4271785 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4271690 PA14_47980*,PA14_47990*,PA14_48000 +,-,+
Raw Sequence Start: 4271562 PA14_47980*,PA14_47990*,PA14_48000 +,-,+
Extrapolated Insert Location:
Default Offset Location: 4271625 PA14_47980*,PA14_47990*,PA14_48000 +,-,+
PA14 BLAST Hit ID: 119826       Show Transposon Map
Identities: 25/26 (96.15%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 14.12%
Query Start: 78 Query End: 103 Subject Start: 243554 Subject End: 243529 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 243554 PA14_02730 +
Raw Sequence Start: 243696 PA14_02730 +
Extrapolated Insert Location:
Default Offset Location: 243633 PA14_02730 +
PAO1 BLAST Hit ID: 119827       Show Transposon Map
Identities: 94/95 (98.94%) BLAST Bit Score: 180.0 Percent of Processed Sequence That Aligns: 53.11%
Query Start: 65 Query End: 159 Subject Start: 1362904 Subject End: 1362810 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1362904 PA1254 +
Raw Sequence Start: 1363033 PA1254 +
Extrapolated Insert Location:
Default Offset Location: 1362970 PA1254 +
PAO1 BLAST Hit ID: 119828       Show Transposon Map
Identities: 25/26 (96.15%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 14.12%
Query Start: 78 Query End: 103 Subject Start: 253403 Subject End: 253378 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 253403 PA0223 +
Raw Sequence Start: 253545 PA0223 +
Extrapolated Insert Location:
Default Offset Location: 253482 PA0223 +
H PA14 Blast Hit H PAO1 Blast Hit