Mutant Report for Mutant ID: 48429

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 36798
Chromat Path: H:\Pa14\MrT7\505v1\505v1_D09_D9_075.ab1 Last Transposon Base: 60 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTNACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACACGGCCAG
CACGAAGATGATCAGGTTGTAGATCCCGTCAGAAATGATATCCATCGTTTTCACCGGTCTTCAGGGCGCA
GGCGCGAGGCGTGCGCATTTATCGTTATCGAAGCTTCCCGACGCAGCGGCTCAGCCGTTCTTGCGCACCG
CCTACCCGCCGGGCACATCATCTGCAGGCCTGGCCAANNNNNNNNNNNNNTNNNNNNTNAANGNTNTTNN
GNNNANNNTTTTTTTTATTAATTTATTATGTTTTNTTCATATTATTTTTTATTTTTTAAAAATATTAAAA
AAAAAAAGTGTTTTGGAAGTATATAGTAAATATATGGGGTAATATATACTGTTAGGTATTGGGTTTATTG
AATTGTTTTTTTGGAGTGTTGTGGAGATTATTACCACTTGGTCCGGTTTTACCACCGCGAGGGGGGATCG
AGGAATGGTATTTGACCCTGGGTGCTCGGATATATTATAGTGAAATCAAAACAATTGCATTGGCACACGG
TTTAGTGTGGTCCCTTGCTCCGGGAGAAACGTGGTTCAATCCTCTCTATTTCCACACCCATACCCATCTG
GGGTCTTTGGCACCCACGGGGGCGATATTTTTTTATTTTTCGATGTCACGCTTTTTTTCTTCGCCCGTTT
GGCGGTTCCTTGTGTTTTTTGTTCCCTTCGTTCCTTTCTCCGTTTCCTCTATTTTTCACGTTATATATCC
TCCCTGCTGAATTTGTATTTTGCGCTTTTTCCCCTCCTTTCTTTCCCCCATTTTCCCCCCTTTTTCCTTC
TTTCT
Blast against PA14
Processed Seqquence ID: 28101
5' Trim Position: 11 3' Trim Position: 249
Processed Sequence:
(Transposon Sequence in Red)
ACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACACGGCCAGCACGAAGATGA
TCAGGTTGTAGATCCCGTCAGAAATGATATCCATCGTTTTCACCGGTCTTCAGGGCGCAGGCGCGAGGCG
TGCGCATTTATCGTTATCGAAGCTTCCCGACGCAGCGGCTCAGCCGTTCTTGCGCACCGCCTACCCGCCG
GGCACATCATCTGCAGGCCTGGCCAANN
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
119313 119313 119314 119314
PA14 BLAST Hit ID: 119313       Show Transposon Map
Identities: 154/154 (100.00%) BLAST Bit Score: 305.0 Percent of Processed Sequence That Aligns: 64.29%
Query Start: 49 Query End: 202 Subject Start: 222086 Subject End: 221933 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 222086 PA14_02460 -
Raw Sequence Start: 222145 PA14_02460 -
Extrapolated Insert Location: 222085 PA14_02460 -
Default Offset Location: 222082 PA14_02460 -
PAO1 BLAST Hit ID: 119314       Show Transposon Map
Identities: 154/154 (100.00%) BLAST Bit Score: 305.0 Percent of Processed Sequence That Aligns: 64.29%
Query Start: 49 Query End: 202 Subject Start: 225350 Subject End: 225197 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 225350 PA0195 -
Raw Sequence Start: 225409 PA0195 -
Extrapolated Insert Location: 225349 PA0195 -
Default Offset Location: 225346 PA0195 -
H PA14 Blast Hit H PAO1 Blast Hit