Mutant Report for Mutant ID: 48256

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 36625
Chromat Path: H:\Pa14\MrT7\503v1\503v1_F04_F4_043.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 3
Raw Sequence:
(Transposon Sequence in Red)
NGTTAGTTAGTATACGATAGTATAGTGGTGTCTAGAGAGCGGAAACTTATCAGCCAACCTGTTACGGCAA
GCTGGTCCGCCAGTTCCCCACCGCAGGCTCGGCCTATACCTACGCGCAACATCATCTGCAGGCCTGGCCA
GGCTTCATGCTCGGATGGTGGTAAAATGGTGGACTACGTGTATGCTACCAATGATGGACGAAATGATGGG
AAAGAACTAGGTGACCGGAATGAATCGGGAAAACGACAATAAATTTGGGTGGTGATGTACGTGGTGATCA
TAAAACTGGGAAGGGTGATCAGGGTGAGTGTGAAAAAAAATTCTGGATAAGTGGTAGGGGAAAAGGGGGG
GGGGGGGAGGAAAAGAAAAAAAAAAGTGGGGATAAAAAATGGGGGGGGAATAAAAAAAAAAAAAATGGGG
GAATGGTTGTGGAATGAAAGTGAAAAAAAAGGGGGGAAAAGGAAGGGGGGGGGGGGGAAAAGGGGGGGGG
GGGGAAAGGGGGGAAAAAAAAAAAAAAATGAAGGGTAGGGGGGGAAAGGGGGGTGAAAAGGAAGTGGGGG
GAAAAAGGAGGGGTGGGGGGATGAAAAAAAAATGTGTGGAAGAGAATGGTGAAGGTAACGGAGGGGGTGA
GATGAAAGGTGGGAAAAAAAAGGTGAAAAAAAAATGGGGGGGAAAAAAGAAAAAAAAGAGGGGAAGAGGG
GGGAAAAAAAAAAGAAAAACGAGGGGTGGGTGGGGTAGAAAAACATGTGGGGGGGGGGAAGTGATACAAA
TAAATAAAGAAGAATATAATATAGGATAAGGTGGGGAAGATAAAGGTGGGGGAAAAAATGTTAAGGTGGG
TGGCATAAATGGCAGTGGATTGGGGTATAAAATAGGGAGCGTGTAGTGAAATAGTTGAATTTGTGTGTGT
TATGTGATAATAGAAATCAATATAAGATAGGTGGTAATAAGTGGGATGGTTGTGGGAN
Blast against PA14
Processed Seqquence ID: 27981
5' Trim Position: 41 3' Trim Position: 129
Processed Sequence:
(Transposon Sequence in Red)
GAAACTTATCAGCCAACCTGTTACGGCAAGCTGGTCCGCCAGTTCCCCACCGCAGGCTCGGCCTATACCT
ACGCGCAACATCATCTGC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
118891 118891 118892 118892
PA14 BLAST Hit ID: 118891       Show Transposon Map
Identities: 58/58 (100.00%) BLAST Bit Score: 115.0 Percent of Processed Sequence That Aligns: 64.77%
Query Start: 22 Query End: 79 Subject Start: 3401777 Subject End: 3401720 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3401777 PA14_38130,PA14_38120* +,+
Raw Sequence Start: 3401839 PA14_38130,PA14_38120* +,+
Extrapolated Insert Location: 3401776 PA14_38130,PA14_38120* +,+
Default Offset Location: 3401776 PA14_38130,PA14_38120* +,+
PAO1 BLAST Hit ID: 118892       Show Transposon Map
Identities: 58/58 (100.00%) BLAST Bit Score: 115.0 Percent of Processed Sequence That Aligns: 64.77%
Query Start: 22 Query End: 79 Subject Start: 2232423 Subject End: 2232480 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2232423 PA2041 +
Raw Sequence Start: 2232361 PA2041 +
Extrapolated Insert Location: 2232424 PA2041 +
Default Offset Location: 2232424 PA2041 +
H PA14 Blast Hit H PAO1 Blast Hit