Mutant Report for Mutant ID: 48252

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 36621
Chromat Path: H:\Pa14\MrT7\503v1\503v1_E12_E12_099.ab1 Last Transposon Base: 60 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTAACGACTAGTATAGGGGTCTAGAGACCGGAGACTTATCAGCCAACCTGTTACAACCACAA
GCAGGTCAGCTTCGACAGCACCGGCCCGCTCGACGACGAGGGACGCTTTCTCTATCGCATCTCCGGCGTG
GTGCGCGACAGCAACACCCAGGTCGACCATATCGACGACAAGCGCTACAACATCGCCCCGAGCCTGACCT
GGAACATCGACGACGACACCAGGCTGACCTTCCTCGGCCAGTTCAACCGCGACGATACCGGCATCACCCG
TCATCTGCTGGCGTGGCCAGGAACCAAGTACGACGCGCCGTTCGGCAAGGTTTCCCACCACAAGAACCTC
GGCGACCCGGACTGGGAATACTACGACCGCACCTCCTATGGAGGGGTGTACACCTTCGAGCGGCGGATCA
ACGATGTCTGGCAGTTCCGCCAGAACCTGCGTTACCTGCGCAACGACCTGTCGTTCCAGGCGGTTACAGC
GGGCACAGTTCATGCCGACGGTACACTGTAACGCAGCACCACCTCGGTGGATGACTACGTCAGTCAGTTC
GTAGTAGATAACAACTTCCAGGCCGACTTTCCAAACAGGCGCCCTGCGCCACACCCTGCTGTTAGGCCTT
GGATACAACCCGCTCCGATAATCAATACACATTCATCTCAGGGCCTGGCCAGTTTGCCTAATTTTTTTTC
TGTTTGTTCTGTTTGTCTGCTTTTGTTCCCTCTTGTTTCCGCTTTTTGTTTTATCTCTGTGTTGTCGCCG
CTCTGGCTGGTTATCGGCGGCTCGCGTTCGCGTTTATTTGCGTGGATTCGCGTACGTTGTCTCCTTTTTG
CTTCTTTTTTCTGCGCTCCTTATTCCCTTTTCTTCTTCCGTTCTCTGTGCGTTCCCTTGTTTTCGC
Blast against PA14
Processed Seqquence ID: 27977
5' Trim Position: 36 3' Trim Position: 501
Processed Sequence:
(Transposon Sequence in Red)
CGGAGACTTATCAGCCAACCTGTTACAACCACAAGCAGGTCAGCTTCGACAGCACCGGCCCGCTCGACGA
CGAGGGACGCTTTCTCTATCGCATCTCCGGCGTGGTGCGCGACAGCAACACCCAGGTCGACCATATCGAC
GACAAGCGCTACAACATCGCCCCGAGCCTGACCTGGAACATCGACGACGACACCAGGCTGACCTTCCTCG
GCCAGTTCAACCGCGACGATACCGGCATCACCCGTCATCTGCTGGCGTGGCCAGGAACCAAGTACGACGC
GCCGTTCGGCAAGGTTTCCCACCACAAGAACCTCGGCGACCCGGACTGGGAATACTACGACCGCACCTCC
TATGGAGGGGTGTACACCTTCGAGCGGCGGATCAACGATGTCTGGCAGTTCCGCCAGAACCTGCGTTACC
TGCGCAACGACCTGTCGTTCCAGGCGGTTACAGCGGGCACAGTTC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
118866 118866 118867 118867 118868 118868
PA14 BLAST Hit ID: 118866       Show Transposon Map
Identities: 423/440 (96.13%) BLAST Bit Score: 722.0 Percent of Processed Sequence That Aligns: 94.19%
Query Start: 24 Query End: 462 Subject Start: 544423 Subject End: 543985 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 544423 PA14_06160 +
Raw Sequence Start: 544482 PA14_06160 +
Extrapolated Insert Location: 544422 PA14_06160 +
Default Offset Location: 544419 PA14_06160 +
PA14 BLAST Hit ID: 118867       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.09%
Query Start: 299 Query End: 318 Subject Start: 714781 Subject End: 714800 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 714781 PA14_08340 +
Raw Sequence Start: 714447
Extrapolated Insert Location: 714507 PA14_08340 +
Default Offset Location: 714510 PA14_08340 +
PAO1 BLAST Hit ID: 118868       Show Transposon Map
Identities: 402/424 (94.81%) BLAST Bit Score: 650.0 Percent of Processed Sequence That Aligns: 90.75%
Query Start: 24 Query End: 446 Subject Start: 531624 Subject End: 531202 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 531624 PA0470 +
Raw Sequence Start: 531683 PA0470 +
Extrapolated Insert Location: 531623 PA0470 +
Default Offset Location: 531620 PA0470 +
H PA14 Blast Hit H PAO1 Blast Hit