Mutant Report for Mutant ID: 48205

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 36574
Chromat Path: H:\Pa14\MrT7\503v1\503v1_B01_B1_011.ab1 Last Transposon Base: 110 Transposon Sequence
Match Quality: 4
Raw Sequence:
(Transposon Sequence in Red)
NGGGGGGGNNGGGNNNNNGGGGNNGGGANGGNGGGGNGGGGGGGNNAATGTCGTTTGTATACGACTCACT
ATATGGGTCTAGAGACCGGACCATTATCAGCCAACCTGTTATAACAACGTCTGGGTCGCCCCCGGCGAGC
CGCGCAACCTGACCATGAGCCTGACCCTGAACTACTGAGCCCTCTACCGCCGCCAGGAAGCCATGCCATG
CAAGGACACACACTGCTGCGGGAAACCCTCCAGCGAATAAAAAGCGAGATTCGCCCGCTTATCAACAGTA
CCAGCACGTTAACAACGGCTGCAATTCGGCACTTCTACAACTTTAATATTCAAACATGACATCGGGTTAT
ATCGCTAACCTAATCCTCTTATTCCAATTTCGTCCTGGACAAACGACTTACCCAAACTTTGCGCATGCAC
TAATAAAGGAATGGTCGGGTTGTGCGTTAAATATGCCTGATTGTTATAAAAAATGTATTGGTGTTGTTGG
AGAGGTAAAAAAAAGGAAAACAGAAGGACGGGGATCAACTGGTGTTGCGCAATACGGGGTACTCGGCTTT
ATTTAATAAGTGGAATATCGTGATTTAGATTTAATTTATATGTTGTTTGTTATCGCGCTTCATAATCACC
GTCATGGGGACTGCATATAGGCAACAACCAGCAATATGGGGTACTTCTCTTTCAATAATAATAGATTGGA
GCAAAAATATTCTGCCGCGAATTTCTCCCTATCGTCTAACTTTTTATATACCTCGCCGCTATACAAATTG
GGGTGAAACAAAGGTCATTCTGAAAAATACATGTTTTACGCCCTCTATGTGTAACGACGGACACATACGC
ACCGCTTTTTTCCCGCTGGCGCTCGCACACAAATTCAGTCGCTANCAAGCACCCCATTAATACTCGCGGT
CGTTCTTTACCACTCTTGTCTTTGCTCCCCCCGAATCACTAATGCGCACAATCACAATAAGTAGAACGCG
CATCTCTAGACATTTCAATACTTTATTTATCACACAATGGGGTTAATGAAGTATAACTAATACGTGTTGT
ATAAACATATTATATGACACAACTTCTTTCTGTACACTTGTTGTTGGTCACTTCTACTATCACAAATGAC
TATTATAAACACTTCTTCATTACAN
Blast against PA14
Processed Seqquence ID: 27943
5' Trim Position: 91 3' Trim Position: 212
Processed Sequence:
(Transposon Sequence in Red)
CATTATCAGCCAACCTGTTATAACAACGTCTGGGTCGCCCCCGGCGAGCCGCGCAACCTGACCATGAGCC
TGACCCTGAACTACTGAGCCCTCTACCGCCGCCAGGAAGCCATGCCATGCA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
118779 118779 118780 118780 118781 118781 118782 118782
PA14 BLAST Hit ID: 118779       Show Transposon Map
Identities: 103/103 (100.00%) BLAST Bit Score: 204.0 Percent of Processed Sequence That Aligns: 84.30%
Query Start: 19 Query End: 121 Subject Start: 5698425 Subject End: 5698323 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5698425 PA14_63960,PA14_63950* +,-
Raw Sequence Start: 5698534 PA14_63960,PA14_63950* +,-
Extrapolated Insert Location: 5698424 PA14_63960,PA14_63950* +,-
Default Offset Location: 5698471 PA14_63960,PA14_63950* +,-
PA14 BLAST Hit ID: 118780       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 15.70%
Query Start: 42 Query End: 61 Subject Start: 856480 Subject End: 856461 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 856480 PA14_09970 +
Raw Sequence Start: 856612 PA14_09970 +
Extrapolated Insert Location: 856502 PA14_09970 +
Default Offset Location: 856549 PA14_09970 +
PAO1 BLAST Hit ID: 118781       Show Transposon Map
Identities: 103/103 (100.00%) BLAST Bit Score: 204.0 Percent of Processed Sequence That Aligns: 84.30%
Query Start: 19 Query End: 121 Subject Start: 5427783 Subject End: 5427681 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5427783 PA4837 +
Raw Sequence Start: 5427892 PA4837 +
Extrapolated Insert Location: 5427782 PA4837 +
Default Offset Location: 5427829 PA4837 +
PAO1 BLAST Hit ID: 118782       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 15.70%
Query Start: 42 Query End: 61 Subject Start: 4666216 Subject End: 4666235 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4666216 PA4168 +
Raw Sequence Start: 4666084 PA4168 +
Extrapolated Insert Location: 4666194 PA4168 +
Default Offset Location: 4666147 PA4168 +
H PA14 Blast Hit H PAO1 Blast Hit