Mutant Report for Mutant ID: 48189

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 36558
Chromat Path: H:\Pa14\MrT7\502v1\502v1_H09_H9_078.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
TAAATATAGTAGAATAAAAAAAAATCTTGTCTTTTAATGTTGATTTTTTTTTTTTTNTTTGTTCGTTTAG
AACGAACAGGCATCATCTGCTGGCAGTGCGCACAATTATCAGCCAACCTGTTACTACCCGTCCAGTGCCA
ATCGCCTGTACGTGGCGATGGGCGAGCCTCGGCAGTTCCAGCTGTCGACGACGGTGGAGTTCTGAGTCGG
CGCTCGTTCCAGGTGGGGTTCCCCGGCGTCCTCCTGGACGTGGAGGCCCCCCCTGAAGGGCGAAGGGTCG
GCGCGATGCTGCCCGACCATGCTCCATCCGGTTCCTTCTTCCCCCAGGGAAGGGATTGCCCGGCACGTGA
GTCGTTCCGCTATCCAGTGCCTTCTCCCATTGGGGAAAGGAAGGCGGAGTACCGCCTGGCACGACCTCGC
CGCACGCCACACCTCGTTCCCAACCCGCCCGTTGGGTACCATACCCGCACCACTCATCTTCTGAGCGGCT
CGCCAATTTTCATCCACCGTAACATCTTCGTGATGTCCAGCTTATTTTTTTTCTTTTTGTTTGCCGTCTT
TTTTCTTTGTTTCATCTCCAACATCCTGTGCATTTTCTTTTCTCTCCCTCTGACTTGCTCTAGAACTGTT
TGTATCCTTTTCTCTATTCTTCTGTCGCCTTTTTTTGTGTTATTCACTTCTCCTGGACTTTGGTTTGTGT
TTTTTTGCGTTTCTCTTTTCCCTCGCTATCCTTTCTTCCTCTTTCTGCTTTGTGTTTTTCTTTCGCGCTT
ATTTTTTGCTTGTCCTCTCTGTCTTTTTCCTTGTCCTGTTTCCTCTGTGTGCCCGTTTTGCCTCCTGTTT
GTGTGCCTCGGGCTTTCTGTTGCGTAGTTTTTTTGTCTGCCCGTCTGTTCACCCCTCTTCACCCTCTCAT
CTCGCTCTAACTTTCTGTCAATCTAGTTTTGTCCCCTCCACGTTTTGTGTCTCC
Blast against PA14
Processed Seqquence ID: 27937
5' Trim Position: 98 3' Trim Position: 467
Processed Sequence:
(Transposon Sequence in Red)
CGCACAATTATCAGCCAACCTGTTACTACCCGTCCAGTGCCAATCGCCTGTACGTGGCGATGGGCGAGCC
TCGGCAGTTCCAGCTGTCGACGACGGTGGAGTTCTGAGTCGGCGCTCGTTCCAGGTGGGGTTCCCCGGCG
TCCTCCTGGACGTGGAGGCCCCCCCTGAAGGGCGAAGGGTCGGCGCGATGCTGCCCGACCATGCTCCATC
CGGTTCCTTCTTCCCCCAGGGAAGGGATTGCCCGGCACGTGAGTCGTTCCGCTATCCAGTGCCTTCTCCC
ATTGGGGAAAGGAAGGCGGAGTACCGCCTGGCACGACCTCGCCGCACGCCACACCTCGTTCCCAACCCGC
CCGTTGGGTACCATACCCG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
118764 118764 118765 118765
PA14 BLAST Hit ID: 118764       Show Transposon Map
Identities: 338/346 (97.68%) BLAST Bit Score: 636.0 Percent of Processed Sequence That Aligns: 93.50%
Query Start: 24 Query End: 369 Subject Start: 172201 Subject End: 172546 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 172201 PA14_01870,PA14_01880* +,-
Raw Sequence Start: 172080 PA14_01870,PA14_01880* +,-
Extrapolated Insert Location:
Default Offset Location: 172143 PA14_01870,PA14_01880* +,-
PAO1 BLAST Hit ID: 118765       Show Transposon Map
Identities: 330/346 (95.37%) BLAST Bit Score: 563.0 Percent of Processed Sequence That Aligns: 93.50%
Query Start: 24 Query End: 369 Subject Start: 173351 Subject End: 173695 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 173351 PA0151 +
Raw Sequence Start: 173230 PA0151 +
Extrapolated Insert Location:
Default Offset Location: 173293 PA0151 +
H PA14 Blast Hit H PAO1 Blast Hit