Mutant Report for Mutant ID: 47948

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 36221
Chromat Path: H:\Pa14\MrT7\500v1\500v1_D08_D8_064.ab1 Last Transposon Base: 61 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCTTCTTT
TCGGTGGCGTTCGACTCCTGCGTCTGCGAAGTGTTACCGGAGCAACTACGCCGGAGCGCAATTCGATTTC
AGGTTATACCCGCGACCTCCATCATCTGCAGGCCTGGCCATGTAGTTTTTTTGCGCTGTTCTAATACGTC
ATCCGCACATCATCTGCTGGCCTGGTCATCTTTGTTTGTCATCTATTTTTTTTTGTACTGAACAGGCCCC
GTCTCTCCTTCACTCACTGCTCATAACAAATGTGGCTTTACCATTTAGAGTGTTTTTGCCTCCACTCCTT
TTTTACAATATTCCTCTCTTTATTTTCTTTTTTCGCTTTTTTTTCTGTACTTGGTTTGTTCTGTTTTTTT
GTGTTGTTTTTTTTTTTTGTTTGGGGTCCCTGGTTCCCTGATTTTTTTTTTGGTTTTTCTGCCTGTCTCA
TTTCTTGTTCTTGGGCGTCGGGTTACTTTGTTATGTCGCGCCATTTCTGTGACCTCATTTATATCCAAAT
CTCCTGCATTATCCTGCTTTCCGGAATGTTTTTGTGTCTTTTCTACTCTCACCTTCCCTTGTTGACTCTC
CTTCAATCACGTTTTTTTTTTTGTTTGTCCTTTTTCCCCCCTGATCTTTCCCCTGTCTTGGCTCCGACAT
TTTCCTCTTTTCTTACGTCTTACTTTTCTATCTTTCCGTCTTTTCTTCCTCCTTTCCTCCTCTCCTCTTC
TGTTTTTCGTCTGGTTCAAGCTTTCTTTCTCTTTGTGCTTTTGTGTCTTTCCTCCCTATTTTTTCTCGGT
CTTTCACGTCTCTTTCTCCGTCTTTCTCTCTTACATCTCCTGTGGTATCTTCATTTCTTTTCTAATCAAT
TATCCGATTGTATTTATTTTCCC
Blast against PA14
Processed Seqquence ID: 27721
5' Trim Position: 1 3' Trim Position: 186
Processed Sequence:
(Transposon Sequence in Red)
GTCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCTTCTTTT
CGGTGGCGTTCGACTCCTGCGTCTGCGAAGTGTTACCGGAGCAACTACGCCGGAGCGCAATTCGATTTCA
GGTTATACCCGCGACCTCCATCATCTGCAGGCCTGGCCATGTAGT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
118043 118043 118044 118044
PA14 BLAST Hit ID: 118043       Show Transposon Map
Identities: 98/99 (98.98%) BLAST Bit Score: 188.0 Percent of Processed Sequence That Aligns: 52.97%
Query Start: 60 Query End: 158 Subject Start: 4171904 Subject End: 4171806 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4171904 PA14_46840 +
Raw Sequence Start: 4171964
Extrapolated Insert Location: 4171903 PA14_46840 +
Default Offset Location: 4171901 PA14_46840 +
PAO1 BLAST Hit ID: 118044       Show Transposon Map
Identities: 97/99 (97.97%) BLAST Bit Score: 180.0 Percent of Processed Sequence That Aligns: 52.97%
Query Start: 60 Query End: 158 Subject Start: 1462743 Subject End: 1462841 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1462743 PA1348 +
Raw Sequence Start: 1462683
Extrapolated Insert Location: 1462744 PA1348 +
Default Offset Location: 1462746 PA1348 +
H PA14 Blast Hit H PAO1 Blast Hit