Mutant Report for Mutant ID: 47481

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 35850
Chromat Path: H:\Pa14\MrT7\495v1\495v1_E09_E9_069.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCCCCTTT
CCCNNNNNNNAAGTGTTCAGTTTGTAAACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCA
ACCTGTTATGATCTGACTAACAGGTCACGAAGAATAGGAACAGTTGCGGAGAATTGCGTTGGATCACCGG
GGTGTGTTTCCGAACTGTATGGGTTGTTTCGGTGCGTAACTGTACCGCTCTGCACCATCATCTGCAGGCC
TGGCCATAATAAATGAATAGTTGCATTAGTAAAATTTATAACGGCCGGTGGCCGCTTTTGCTGAGGCGGG
AAAGAGCAAAGGTCGCCTAAAATTTAATTATCATATTTTTTTCTGATCAGATTAAATTTCTAAATATAAT
TAATTTTTTAATATTGAAGAAAAATGCTGATAAATAAGTTTTATTTTTGTCATATATCATTTACAATTTA
CTTCTAAGATTTCTTTCTTTTAACGATATCTGAACAATATTTTTTTTTCGCGACAGACTTTAAGTTAGCG
CCTCGCCGACTGACCCTCTTTTTTTGCCCGCGCTTTTTCTTGCGCACACTATTCTCTATATATCTACGGG
CCTCTTACCGGAGATGGGGATTGCGTATGTATGCGATGTCTCTCTTGGTATCAACCATTGCTTATCTTTT
TGTTTATTGTTTTTTTATTATTAATGACGTTAGTTATGTCCAAAAAAACGGCGTCGGATACTTTATACAA
AATTATTAATCAATCAATTATTGTCATAAATAGATATCAACGAGATTATATTTTCATTGTTTAGGTATTC
TAACATTTCTTTCATCTATTTGTATCCTACAACCACGTCTTTCCTCTCTGCCCCTTGTGTCCTTTATCTT
GTACTAGGACGAAATATAAAAAATTTTTGACTATCATATTAACCCCATATACTTCTACAATCTTAATCCA
CAACCATCATTCTAATTCCCCCCCCCCCTC
Blast against PA14
Processed Seqquence ID: 27516
5' Trim Position: 91 3' Trim Position: 289
Processed Sequence:
(Transposon Sequence in Red)
TTGTAAACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATGATCTGACTAAC
AGGTCACGAAGAATAGGAACAGTTGCGGAGAATTGCGTTGGATCACCGGGGTGTGTTTCCGAACTGTATG
GGTTGTTTCGGTGCGTAACTGTACCGCTCTGCACCATCATCTGCAGGCCTGGCCATAA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
117356 117356 117357 117357
PA14 BLAST Hit ID: 117356       Show Transposon Map
Identities: 122/125 (97.60%) BLAST Bit Score: 224.0 Percent of Processed Sequence That Aligns: 62.63%
Query Start: 56 Query End: 180 Subject Start: 6408568 Subject End: 6408444 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6408568
Raw Sequence Start: 6408714 PA14_71900 -
Extrapolated Insert Location:
Default Offset Location: 6408651 PA14_71900 -
PAO1 BLAST Hit ID: 117357       Show Transposon Map
Identities: 122/125 (97.60%) BLAST Bit Score: 224.0 Percent of Processed Sequence That Aligns: 62.63%
Query Start: 56 Query End: 180 Subject Start: 6135647 Subject End: 6135523 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6135647
Raw Sequence Start: 6135793 PA5446 -
Extrapolated Insert Location:
Default Offset Location: 6135730 PA5446 -
H PA14 Blast Hit H PAO1 Blast Hit