Mutant Report for Mutant ID: 47470

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 35839
Chromat Path: H:\Pa14\MrT7\495v1\495v1_D10_D10_080.ab1 Last Transposon Base: 25 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
CCGGGGACTTATCAGCCAACCTGTTACCGTTCCGGTGCATGGCGACGCACGCGGTCTGGAAGCGGTGCTG
CTGGAGATCCGCAACGATGGATTGCGCACGCCGGATGCGGTGAGCGCCTGGGCCGAGCGTCTGTATCCCT
GGCTCTGATGCGATGACCGGCGCCGCCGGTCGCCAATAACGAGAAAGAGGCCCGCTTCGCGTGCGGCGCC
GATAACGACAATACGCTGCCTTTTCCCGAGGAGCCCGTCATGGCCATCGAACAGTTCGGATACCGGCAAC
AGCCATCATCTGGACGGCTGGTCAGCGACCTGATCATCTACGGGATGATCTTCATGATCCCCATCGCCCC
GTTCGGGGTCTACGGCTGGGTCCATGCCGACGCCCACGGCATGGTGCCGATGGCCTACCTGGTGGGCATG
CTGGTGTTACTTCTTCACCCCCATCTTCCTGCATGTCTGCCCATTTCTTTTTTTTTCTCTCTCATTCCCT
TTTTTTATTCCTCTCCACCTCTTCCATACCAATGTTTATTTCTCTTATTGCTACCATTCTCTCCCTACCT
ATCAATAATACTCCCTTTTTTTTCCTTTCTTTATCTTTATATCTATCTACTCCATTACTAATTATCTCTT
TTTTTATACCACATTTTACATTAATCAATTATCACCTTACTTTTAATTCTAACATTAATCATCAATATAT
TTTTTATTCTATCCTGTTTTTCTTGTCCCATTAAACCACTATTGACAACCTCCTCTTTCCCGCTTCCTTC
TTTTCCTTTCTTTTTCGCTTTGCTCTCTTCTTTACTTTCTCCTCCTACG
Blast against PA14
Processed Seqquence ID: 27511
5' Trim Position: 1 3' Trim Position: 394
Processed Sequence:
(Transposon Sequence in Red)
CGGGGACTTATCAGCCAACCTGTTACCGTTCCGGTGCATGGCGACGCACGCGGTCTGGAAGCGGTGCTGC
TGGAGATCCGCAACGATGGATTGCGCACGCCGGATGCGGTGAGCGCCTGGGCCGAGCGTCTGTATCCCTG
GCTCTGATGCGATGACCGGCGCCGCCGGTCGCCAATAACGAGAAAGAGGCCCGCTTCGCGTGCGGCGCCG
ATAACGACAATACGCTGCCTTTTCCCGAGGAGCCCGTCATGGCCATCGAACAGTTCGGATACCGGCAACA
GCCATCATCTGGACGGCTGGTCAGCGACCTGATCATCTACGGGATGATCTTCATGATCCCCATCGCCCCG
TTCGGGGTCTACGGCTGGGTCCATGCCGACGCCCACGGCATGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
117298 117298 117299 117299 117300 117300 117301 117301
PA14 BLAST Hit ID: 117298       Show Transposon Map
Identities: 259/259 (100.00%) BLAST Bit Score: 513.0 Percent of Processed Sequence That Aligns: 65.65%
Query Start: 24 Query End: 282 Subject Start: 6474749 Subject End: 6475007 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6474749 PA14_72700 +
Raw Sequence Start: 6474725 PA14_72700 +
Extrapolated Insert Location: 6474750 PA14_72700 +
Default Offset Location: 6474788 PA14_72700 +
PA14 BLAST Hit ID: 117299       Show Transposon Map
Identities: 91/91 (100.00%) BLAST Bit Score: 180.0 Percent of Processed Sequence That Aligns: 22.90%
Query Start: 303 Query End: 393 Subject Start: 6475028 Subject End: 6475118 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6475028 PA14_72710 +
Raw Sequence Start: 6474725 PA14_72700 +
Extrapolated Insert Location: 6474750 PA14_72700 +
Default Offset Location: 6474788 PA14_72700 +
PAO1 BLAST Hit ID: 117300       Show Transposon Map
Identities: 256/259 (98.84%) BLAST Bit Score: 490.0 Percent of Processed Sequence That Aligns: 65.65%
Query Start: 24 Query End: 282 Subject Start: 6201510 Subject End: 6201768 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6201510 PA5509 +
Raw Sequence Start: 6201486 PA5509 +
Extrapolated Insert Location: 6201511 PA5509 +
Default Offset Location: 6201549 PA5509 +
PAO1 BLAST Hit ID: 117301       Show Transposon Map
Identities: 90/91 (98.90%) BLAST Bit Score: 172.0 Percent of Processed Sequence That Aligns: 22.90%
Query Start: 303 Query End: 393 Subject Start: 6201789 Subject End: 6201879 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6201789 PA5510 +
Raw Sequence Start: 6201486 PA5509 +
Extrapolated Insert Location: 6201511 PA5509 +
Default Offset Location: 6201549 PA5509 +
H PA14 Blast Hit H PAO1 Blast Hit