Mutant Report for Mutant ID: 47037

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 35406
Chromat Path: H:\Pa14\MrT7\490v1\490v1_H09_H9_078.ab1 Last Transposon Base: 62 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACTACACC
CAGCAACTGGGCCTGGGCTTCGACGAGATCAGCGCCGGCAACCTGCTACTGGTCGACGAAGACCTCAACG
TCCTCCACGGGCACGGCATGGCGAATCCGGCCAATCGCTTCCACAGCTGGGTCTACCGCGCCCGCCCGGA
CGTCAATTGCATCATCCATACCCACCCGCTACATCATCTGAAGGCCTGGCCAAAGNANNTACNGCTGCNN
GTCTCGCACATGGACCTTTGCCCGCTATACGACGACCGCGCATCATCTGCAGGCCTGGCCAACTTGTTCT
TTTTTCTTCTCGCCTCCTTGTTTCTCTCTTCTTTGTTTGTTGCTGTTCTGTCCGCGTGTGTCGCTTCCTC
TGTTTCCTGGCTGCGTTGTGCTTTCTTGTGTGTCGTTCTGTTTGTCCTGCGTCGCTGTCTCCCTCCCTCT
CCTTTGTCCTGTCCTCTCTGTGCTGGAGTTCTCTGCGTAGGCTTGATGCCCCCGGGCTTGCAGCTACTTA
TTTCTGTTGTTCCGTATTGTGGTTTTTCCCCCTCCTGTTGTATCGCCCTATTGGCCGGATGTGCATCTGT
GGGGTTATCGCGGTGCGGTTCGCCGTCTGGCGGGTTGTGCTTCTTGGCTTTGTCTTGTTGTATGTGGTTG
GTACTAGCTGTCTTTGTTTCTTGTTCTTTAGTGTTGGCTTCTCTGTGCTAGATCTCTCTTTATATCCCTT
AATATTTTTTAGTCTTCGCTTGGCTTTACCCCATCTTTCCCATGTAACAACTTCATCGCAAACGATGACT
AGAATCACTCCAGTAAACTTCTCGTTTTGGTTGATTTGAAGTCTG
Blast against PA14
Processed Seqquence ID: 27246
5' Trim Position: 4 3' Trim Position: 342
Processed Sequence:
(Transposon Sequence in Red)
GTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACTACACCCAGC
AACTGGGCCTGGGCTTCGACGAGATCAGCGCCGGCAACCTGCTACTGGTCGACGAAGACCTCAACGTCCT
CCACGGGCACGGCATGGCGAATCCGGCCAATCGCTTCCACAGCTGGGTCTACCGCGCCCGCCCGGACGTC
AATTGCATCATCCATACCCACCCGCTACATCATCTGAAGGCCTGGCCAAAGNANNTACNGCTGCNNGTCT
CGCACATGGACCTTTGCCCGCTATACGACGACCGCGCATCATCTGCAGGCCTGGCCAA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
116569 116569 116570 116570 116571 116571 116572 116572
PA14 BLAST Hit ID: 116569       Show Transposon Map
Identities: 179/179 (100.00%) BLAST Bit Score: 355.0 Percent of Processed Sequence That Aligns: 52.66%
Query Start: 58 Query End: 236 Subject Start: 244595 Subject End: 244417 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 244595 PA14_02740 +
Raw Sequence Start: 244656 PA14_02740 +
Extrapolated Insert Location: 244594 PA14_02740 +
Default Offset Location: 244593 PA14_02740 +
PA14 BLAST Hit ID: 116570       Show Transposon Map
Identities: 48/52 (92.30%) BLAST Bit Score: 77.8 Percent of Processed Sequence That Aligns: 15.09%
Query Start: 266 Query End: 317 Subject Start: 244387 Subject End: 244336 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 244387 PA14_02740 +
Raw Sequence Start: 244656 PA14_02740 +
Extrapolated Insert Location: 244594 PA14_02740 +
Default Offset Location: 244593 PA14_02740 +
PAO1 BLAST Hit ID: 116571       Show Transposon Map
Identities: 175/179 (97.76%) BLAST Bit Score: 323.0 Percent of Processed Sequence That Aligns: 52.66%
Query Start: 58 Query End: 236 Subject Start: 254444 Subject End: 254266 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 254444 PA0224 +
Raw Sequence Start: 254505 PA0224 +
Extrapolated Insert Location: 254443 PA0224 +
Default Offset Location: 254442 PA0224 +
PAO1 BLAST Hit ID: 116572       Show Transposon Map
Identities: 48/52 (92.30%) BLAST Bit Score: 77.8 Percent of Processed Sequence That Aligns: 15.09%
Query Start: 266 Query End: 317 Subject Start: 254236 Subject End: 254185 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 254236 PA0224 +
Raw Sequence Start: 254505 PA0224 +
Extrapolated Insert Location: 254443 PA0224 +
Default Offset Location: 254442 PA0224 +
H PA14 Blast Hit H PAO1 Blast Hit