Mutant Report for Mutant ID: 45321

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 33690
Chromat Path: H:\Pa14\MrT7\473v1\473v1_A09_A9_067.ab1 Last Transposon Base: 116 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
GGGGGGTGTTGTTTTTGNTGTGTTTGTGTGGTTTTTNTTNNNGCCGANNCACAGTGTTCGTTTTATACGA
CTACTATAGGGGTCTAGAGACCGGGAGACTTATCAGCCAACCTGTTACATGGGCATCTGGTTCCCCGACG
TGCCGCGCTGGATCTGGGCCCTGGCGGCCCTGGCGAGCATGGGCACGATCAACCTCATCGCGGTGCGTGC
CTTCGGCGAGTTCGAGTTCTGGTTCGCCCTGATCAAGATCGTCACCATCCTGGCGATGGCGGTGGACGGC
ATCTGCATGATCGCCTTCGGCTTCGGCAACTACGGCATCGCCACCGGTATCTCCAACCTCTGGGTCCACG
GCCGCTTCATGTCCAATGGTATCCAGGGCGTGCTGATGTCACTGCTGATGGTGATGTTCGCCTACCTCGG
GGCGGAAATGATCGGCCTCTCCGGCGGCGTAGCGCGTTTCCCGACCAAGAGCACTCCCTGGCTGATCAAC
CCGCGGTTTCTGCGGCAACTCGGCTGTTTCCTATTGTTCAATTCATTGTTTCCCGATCCTCTACGCCCTA
CCCCGCCTGACCTTTCTTTGTCTCCTATTGTCTTTCCCTTCCTCGATGACCTTGCGCGTCCCATGGTGTA
TCAGGAACCGTTGATCCGGTGTTCATTCACTCTTCCTTGGTCGCCTTCCCTCCCGCCCCTGTTTTCCCTT
CTTCCCTCCTCCTTCTTCTCTCCCCCCCTTTCCCCTTAGTTCTTACATTCTCCCCTTCCCATTTTTCTTT
GCTCTCTTCCCCCCCCTTCCCTGTCTGTCTACGTGCCCGGTGTGCTCTCTTTCTATCTCTTGACGCTGCT
ATTGTCTACCTCGTTGGATCTCTGGGTGTTGGCATGTGTCACGTTGCCTTAGGACCGTTCGTCTGACCCG
CGCGTTCCATTCGTGTTGGTGCTGAGCTGCGTGTCGATGATTGACNTGAGGTGTTGCNCGCCCGACCGCC
TAGTCCTCATATCTTACTTCTCTCTCTTCAACCTTCTCTCATATTACTTCCGTCCTCTCCCGTCGCCGCT
CCGCGTGTCG
Blast against PA14
Processed Seqquence ID: 25994
5' Trim Position: 73 3' Trim Position: 306
Processed Sequence:
(Transposon Sequence in Red)
CTATAGGGGTCTAGAGACCGGGAGACTTATCAGCCAACCTGTTACATGGGCATCTGGTTCCCCGACGTGC
CGCGCTGGATCTGGGCCCTGGCGGCCCTGGCGAGCATGGGCACGATCAACCTCATCGCGGTGCGTGCCTT
CGGCGAGTTCGAGTTCTGGTTCGCCCTGATCAAGATCGTCACCATCCTGGCGATGGCGGTGGACGGCATC
TGCATGATCGCCTTCGGCTTCGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
111922 111922 111923 111923 111924 111924 111925 111925 111926 111926 111927 111927 111928 111928 111929 111929 111930 111930 111931 111931
PA14 BLAST Hit ID: 111922       Show Transposon Map
Identities: 188/191 (98.42%) BLAST Bit Score: 355.0 Percent of Processed Sequence That Aligns: 81.55%
Query Start: 43 Query End: 233 Subject Start: 4792935 Subject End: 4792745 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4792935 PA14_54040 +
Raw Sequence Start: 4793050 PA14_54040 +
Extrapolated Insert Location: 4792934 PA14_54040 +
Default Offset Location: 4792987 PA14_54040 +
PA14 BLAST Hit ID: 111923       Show Transposon Map
Identities: 40/43 (93.02%) BLAST Bit Score: 61.9 Percent of Processed Sequence That Aligns: 18.03%
Query Start: 43 Query End: 85 Subject Start: 6011757 Subject End: 6011715 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6011757 PA14_67310,PA14_67290* +,-
Raw Sequence Start: 6011872 PA14_67310,PA14_67290* +,-
Extrapolated Insert Location: 6011756 PA14_67310,PA14_67290* +,-
Default Offset Location: 6011809 PA14_67310,PA14_67290* +,-
PA14 BLAST Hit ID: 111924       Show Transposon Map
Identities: 39/43 (90.69%) BLAST Bit Score: 54.0 Percent of Processed Sequence That Aligns: 18.03%
Query Start: 132 Query End: 174 Subject Start: 5467792 Subject End: 5467834 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5467792 PA14_61240*,PA14_61250 -,+
Raw Sequence Start: 5467588 PA14_61240*,PA14_61250 -,+
Extrapolated Insert Location: 5467704 PA14_61240*,PA14_61250 -,+
Default Offset Location: 5467651 PA14_61240*,PA14_61250 -,+
PA14 BLAST Hit ID: 111925       Show Transposon Map
Identities: 31/34 (91.17%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 14.16%
Query Start: 141 Query End: 174 Subject Start: 144841 Subject End: 144808 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 144841 PA14_01570*,PA14_01580 +,+
Raw Sequence Start: 145054 PA14_01570*,PA14_01580 +,+
Extrapolated Insert Location: 144938 PA14_01570*,PA14_01580 +,+
Default Offset Location: 144991 PA14_01570*,PA14_01580 +,+
PA14 BLAST Hit ID: 111926       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 12.02%
Query Start: 136 Query End: 164 Subject Start: 2210618 Subject End: 2210646 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2210618 PA14_25260*,PA14_25270 -,+
Raw Sequence Start: 2210410 PA14_25260*,PA14_25270 -,+
Extrapolated Insert Location: 2210526 PA14_25260*,PA14_25270 -,+
Default Offset Location: 2210473 PA14_25260*,PA14_25270 -,+
PAO1 BLAST Hit ID: 111927       Show Transposon Map
Identities: 187/191 (97.90%) BLAST Bit Score: 347.0 Percent of Processed Sequence That Aligns: 81.55%
Query Start: 43 Query End: 233 Subject Start: 864452 Subject End: 864642 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 864452 PA0789 +
Raw Sequence Start: 864337 PA0789 +
Extrapolated Insert Location: 864453 PA0789 +
Default Offset Location: 864400 PA0789 +
PAO1 BLAST Hit ID: 111928       Show Transposon Map
Identities: 40/43 (93.02%) BLAST Bit Score: 61.9 Percent of Processed Sequence That Aligns: 18.03%
Query Start: 43 Query End: 85 Subject Start: 5739498 Subject End: 5739456 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5739498 PA5097 +
Raw Sequence Start: 5739613 PA5097 +
Extrapolated Insert Location: 5739497 PA5097 +
Default Offset Location: 5739550 PA5097 +
PAO1 BLAST Hit ID: 111929       Show Transposon Map
Identities: 32/34 (94.11%) BLAST Bit Score: 52.0 Percent of Processed Sequence That Aligns: 14.16%
Query Start: 141 Query End: 174 Subject Start: 146925 Subject End: 146892 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 146925 PA0129 +
Raw Sequence Start: 147138 PA0129 +
Extrapolated Insert Location: 147022 PA0129 +
Default Offset Location: 147075 PA0129 +
PAO1 BLAST Hit ID: 111930       Show Transposon Map
Identities: 34/37 (91.89%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 15.45%
Query Start: 138 Query End: 174 Subject Start: 5195818 Subject End: 5195854 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5195818 PA4628 +
Raw Sequence Start: 5195608 PA4628 +
Extrapolated Insert Location: 5195724 PA4628 +
Default Offset Location: 5195671 PA4628 +
PAO1 BLAST Hit ID: 111931       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 12.02%
Query Start: 136 Query End: 164 Subject Start: 3358725 Subject End: 3358697 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3358725 PA3000 +
Raw Sequence Start: 3358933 PA3000 +
Extrapolated Insert Location: 3358817 PA3000 +
Default Offset Location: 3358870 PA3000 +
H PA14 Blast Hit H PAO1 Blast Hit