Mutant Report for Mutant ID: 45119

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 33488
Chromat Path: H:\Pa14\MrT7\470v1\470v1_H11_H11_094.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
TGTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACTGGGGACTTATCAGCCAACCTGTTAGGTGGA
GCCGGCGTGGTAGGGGATCTGCCGCGGCGCCACCGGCATCGGCAGCAGGCCGATACCCCCACGCATCTTC
TTCTGAAGGTCTGGACATACATCCATTTCGGTGGCGAAGAGGGNNNGNNTGTGNGNNGGTTGGGGCATCG
CCTTCTACGAAGAAGGCGACGTGCAATTGTTCCAGGACCCGCTGGAGAGCGTTTATTCGGAGGTGGAGCG
CCTGGAGCAGCTCTTCCCGATAAAGAGCGAGACGGTCATCGGGCATATACCTCTGGACTGATTTTTGTGG
GGAGGGGCAAAAGNGAAGTCGACGTCTATAAGGGGGGAAGTTAAGGGCTGAATAAGACGAGGTATATACA
CAATGTTAATCATGGGGGAACTGTGCCTATAGAAGGTGGTATGGTACGTAACTAGGTGGTTAGGGATGAT
CTGATAATGGCGGCGAATTTGCGAGCATGGGAGAACCTAGGAGGGTAGTGGGTATTTAATAAAAAGAACC
TAGTTGCGGTTTTAATTCAGAGGTCGAATACCTTGTAGGATAGCTTGGCGGTAACGTTGGACACTGAAAA
CTTGTGATCAGGAAAGGGCTGGGGGTATAAAAGGGCATACTAATATCACGAGAGCAGGGGCCGGAGTTGG
TTGCTGGGAACCTCCTCTATGATGTGCTGCGGATAAACACATTTGGATCATTAATATTTGTATGGATAAC
AGAGGCGCCAGGGTACCGTCGTGACCGGCTCCCTCCTTTGTTAATCTCCATCAGCGCCGCGCCTCNAACT
CTGTTGTGTTTTTTCTCCATGGATGTAATAAAAGTATTGTCATTAGCGTGAGAAATCGTGTATATCTATT
AGTGTAGAGTCGCTGCCTAACGATTGAANCGGCACTAGTCACGTGCTTTATAGTTAAAATAAGTGTGGGC
CCCACGTCTTGTTTCATGATGATGATCACCCGCTAGTGAGTCGTGCTGTTTAGAGTTTGTCTTGGGCGCA
GTTATCGATGAGNGTTGCGGAAGACAGTTTATGCTAGGTGGGCGGNTTACTGTTTATACGATTGAGAN
Blast against PA14
Processed Seqquence ID: 25837
5' Trim Position: 13 3' Trim Position: 130
Processed Sequence:
(Transposon Sequence in Red)
ACGACTCACTATAGGGGTCTAGAGACTGGGGACTTATCAGCCAACCTGTTAGGTGGAGCCGGCGTGGTAG
GGGATCTGCCGCGGCGCCACCGGCATCGGCAGCAGGCCGATACCCCC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
111362 111362 111363 111363 111364 111364 111365 111365 111366 111366 111367 111367
PA14 BLAST Hit ID: 111362       Show Transposon Map
Identities: 66/66 (100.00%) BLAST Bit Score: 131.0 Percent of Processed Sequence That Aligns: 55.56%
Query Start: 50 Query End: 115 Subject Start: 94173 Subject End: 94238 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 94173 PA14_00930*,PA14_00940,PA14_00950* +,-,+
Raw Sequence Start: 94111 PA14_00930*,PA14_00940 +,-
Extrapolated Insert Location: 94174 PA14_00930*,PA14_00940,PA14_00950* +,-,+
Default Offset Location: 94174 PA14_00930*,PA14_00940,PA14_00950* +,-,+
PA14 BLAST Hit ID: 111363       Show Transposon Map
Identities: 29/30 (96.66%) BLAST Bit Score: 52.0 Percent of Processed Sequence That Aligns: 24.79%
Query Start: 71 Query End: 100 Subject Start: 3816771 Subject End: 3816800 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3816771 PA14_42930*,PA14_42920 +,-
Raw Sequence Start: 3816688 PA14_42930*,PA14_42920 +,-
Extrapolated Insert Location: 3816751 PA14_42930*,PA14_42920 +,-
Default Offset Location: 3816751 PA14_42930*,PA14_42920 +,-
PA14 BLAST Hit ID: 111364       Show Transposon Map
Identities: 22/22 (100.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 17.95%
Query Start: 88 Query End: 109 Subject Start: 6430535 Subject End: 6430514 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6430535 PA14_72160*,PA14_72170 +,-
Raw Sequence Start: 6430635 PA14_72160*,PA14_72170 +,-
Extrapolated Insert Location: 6430572 PA14_72160*,PA14_72170 +,-
Default Offset Location: 6430572 PA14_72160*,PA14_72170 +,-
PAO1 BLAST Hit ID: 111365       Show Transposon Map
Identities: 66/66 (100.00%) BLAST Bit Score: 131.0 Percent of Processed Sequence That Aligns: 55.56%
Query Start: 50 Query End: 115 Subject Start: 96525 Subject End: 96590 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 96525 PA0079 -
Raw Sequence Start: 96463 PA0079 -
Extrapolated Insert Location: 96526 PA0079 -
Default Offset Location: 96526 PA0079 -
PAO1 BLAST Hit ID: 111366       Show Transposon Map
Identities: 29/30 (96.66%) BLAST Bit Score: 52.0 Percent of Processed Sequence That Aligns: 24.79%
Query Start: 71 Query End: 100 Subject Start: 1818044 Subject End: 1818015 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1818044 PA1667 -
Raw Sequence Start: 1818127 PA1667 -
Extrapolated Insert Location: 1818064 PA1667 -
Default Offset Location: 1818064 PA1667 -
PAO1 BLAST Hit ID: 111367       Show Transposon Map
Identities: 22/22 (100.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 17.95%
Query Start: 88 Query End: 109 Subject Start: 6157617 Subject End: 6157596 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6157617 PA5468 -
Raw Sequence Start: 6157717 PA5468 -
Extrapolated Insert Location: 6157654 PA5468 -
Default Offset Location: 6157654 PA5468 -
H PA14 Blast Hit H PAO1 Blast Hit