Mutant Report for Mutant ID: 44962

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 33331
Chromat Path: H:\Pa14\MrT7\469v1\469v1_C10_C10_072.ab1 Last Transposon Base: 65 Transposon Sequence
Match Quality: 7
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTACGAACCGAACAGGCATCATCTGCTGGCGTCCGCACAATTATCCGCCAACCTGATAAATG
GGGCTATGCATGATCACCTCCTTGATCTCGTCGCGTGTCAGCCCGTTCATCTTCGCCGCGCTCAGATGCA
GCTTGAGTTCCTCGTTGCGGTTCATGCCGATCAGCATGGCGATGGTGACCAGGCTGCGGGTGTGTCGCGG
CAGCCCCGGACGGGTCCAGATGTCGCCCCAGGCGTGGCGGGTGATCATCTCCTGGAACTCTTCGTTGAAC
GGCGTCAGGTTGGCCAGGCCCTTCATAAAATCACCCTCCACAAAAAATCAAAACGCGCGTCGCATTGTCG
GATCTTCTCAATCTTATGTTCAAATCCACTTAATATGAGCTGACAGAGGAAATTCTCTTTTCATTCGATC
AAGCCTCCGACCCCCTTCTAATTCTGTTTTTTCTTATTAATAACGACAAAATCAACGTGATGTCCAATTT
ACCCCGACCAGGCACACACCTCCACCATGCCCAGACGTTGTACCCTCCTGCTCGCGTTCTCCGAGTTACT
TATGAACAAAACCAGCAGATCAAGTACCATATCAGAAAATTTTTTTTTACTTATATATCAACTTCATTGT
TCATACTGCGTCTTTGTTTATTCTACTCAACAATCATTCCCTCATCTCAAACATTGTTGTAATTATCTCG
ATTTTTTAATCTACTTATTACTTCATTGTTCCACGCACCCCACCTATCCCTTCCGCTCACTGTCCTATAG
CGCTTCTCGACTTCAAGCCTATCGGCGTATCGCATAGAACCCCTCCTGCTCCCACACTCTCGGTGTTCGG
TCCTTTTCCACTTCAAATACATTTAACATTTACTCTCGTAACTTGATTGCTGTTCACAAAAAATCTCCTC
TTCCAACTCCCATTTCTTTATTCCCTCTATCATTGACTTCATTGAGTAAGTAACTCCGATCTCCTCCTTT
AGGAAGTATTGTCACTTCGCTTCGATATGTTCGTCCACAGTACAATCATGCTTT
Blast against PA14
Processed Seqquence ID: 25699
5' Trim Position: 81 3' Trim Position: 279
Processed Sequence:
(Transposon Sequence in Red)
GATCACCTCCTTGATCTCGTCGCGTGTCAGCCCGTTCATCTTCGCCGCGCTCAGATGCAGCTTGAGTTCC
TCGTTGCGGTTCATGCCGATCAGCATGGCGATGGTGACCAGGCTGCGGGTGTGTCGCGGCAGCCCCGGAC
GGGTCCAGATGTCGCCCCAGGCGTGGCGGGTGATCATCTCCTGGAACTCTTCGTTGAA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
110818 110818 110819 110819
PA14 BLAST Hit ID: 110818       Show Transposon Map
Identities: 192/198 (96.96%) BLAST Bit Score: 345.0 Percent of Processed Sequence That Aligns: 99.49%
Query Start: 1 Query End: 198 Subject Start: 252424 Subject End: 252227 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 252424 PA14_02850 -
Raw Sequence Start: 252505 PA14_02850 -
Extrapolated Insert Location: 252440 PA14_02850 -
Default Offset Location: 252442 PA14_02850 -
PAO1 BLAST Hit ID: 110819       Show Transposon Map
Identities: 191/198 (96.46%) BLAST Bit Score: 337.0 Percent of Processed Sequence That Aligns: 99.49%
Query Start: 1 Query End: 198 Subject Start: 262274 Subject End: 262077 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 262274 PA0232 -
Raw Sequence Start: 262355 PA0232 -
Extrapolated Insert Location: 262290 PA0232 -
Default Offset Location: 262292 PA0232 -
H PA14 Blast Hit H PAO1 Blast Hit