Mutant Report for Mutant ID: 44794

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 33163
Chromat Path: H:\Pa14\MrT7\467v1\467v1_E10_E10_083.ab1 Last Transposon Base: 64 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
GTTCAGTTTGTATACGACTCACTATAGGGTGTCTAGAGACCGGAGACTTATCAGCCAACCTGTTACGTCG
ATGAAGCGGCGGGTGTCGCCGGAGCTGTCCTTGAAGCAGACGATGTTCTCGCAGTCGGCCAGGGAAACCA
GGATGTCCGGGGTGACATCGTTCCGGTAGATCGGCGGGTTGTTGTAGACCATCATCTGCAGGCCTGGCCA
CTCATCTGTGCATAGGATATGNTNGGNGGNGTCGTGCGGTTTGGAGGAATAGACCAGCGCCGGCATCACC
GTGATGCCGTCGACGCCGACCCGCTCCACCGCCTTGGCCACCTTCGCCGCGCCGGTGCTGGTGAACTCGG
CGATCCCGCAAATCACCTGCACGCGGCCGCCGTAGGATCCCTTGGGGACCTCGTTGACGGCTTTCTTCTC
CTCAATGGTCAGGAGGTGTTCTCGCCGACGGTGCCATATACCAACAGCCCGGATTTTCTGTCGCCCTGTT
TAATTGGAAATGACGTTGTGGGTTTCTTCCCAGTTCACCTTACAAATCGTCTGTTTTTTGGGTATAACTC
CATAAAAAAAGTCTCCTCTCCTACTATTGTTGTCTGGAAAATGTTGGTGGGTAGGTAGGAGAAGGGGGTG
GCAGTTAAAATATAAGATTAAGAAGTGGCGAGTATATGGGTGGCAATTCGATCTAGCGATGAGAGGGGGT
ATGCGATCTAAATTAAGGTGGACGTAACGATGGGCGAAATTATATATCTTGTTGGAGAAAGATTAGTTGG
GGCGCAAAATAGAAATACTTTTAAATCTGAGTGCCTGGGTGGGGGGGGTTCCACGAAACATTCTTTTTAT
GTTTTGTCGCAGCGCGAAACACTAAGGGGGGTGAAACATAACAGGGGGTGGGAAGAGACAAGAGGGGGGA
GTAA
Blast against PA14
Processed Seqquence ID: 25556
5' Trim Position: 37 3' Trim Position: 323
Processed Sequence:
(Transposon Sequence in Red)
GACCGGAGACTTATCAGCCAACCTGTTACGTCGATGAAGCGGCGGGTGTCGCCGGAGCTGTCCTTGAAGC
AGACGATGTTCTCGCAGTCGGCCAGGGAAACCAGGATGTCCGGGGTGACATCGTTCCGGTAGATCGGCGG
GTTGTTGTAGACCATCATCTGCAGGCCTGGCCACTCATCTGTGCATAGGATATGNTNGGNGGNGTCGTGC
GGTTTGGAGGAATAGACCAGCGCCGGCATCACCGTGATGCCGTCGACGCCGACCCGCTCCACCGCCTTGG
CCACCT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
110247 110247 110248 110248 110249 110249 110250 110250 110251 110251 110252 110252
PA14 BLAST Hit ID: 110247       Show Transposon Map
Identities: 131/131 (100.00%) BLAST Bit Score: 260.0 Percent of Processed Sequence That Aligns: 45.45%
Query Start: 27 Query End: 157 Subject Start: 4271840 Subject End: 4271710 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4271840 PA14_47990*,PA14_48000 +,-
Raw Sequence Start: 4271903 PA14_47990*,PA14_48000 +,-
Extrapolated Insert Location: 4271839 PA14_47990*,PA14_48000 +,-
Default Offset Location: 4271840 PA14_47990*,PA14_48000 +,-
PA14 BLAST Hit ID: 110248       Show Transposon Map
Identities: 80/82 (97.56%) BLAST Bit Score: 147.0 Percent of Processed Sequence That Aligns: 28.32%
Query Start: 205 Query End: 286 Subject Start: 4271662 Subject End: 4271581 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4271662 PA14_47980*,PA14_47990*,PA14_48000 -,+,-
Raw Sequence Start: 4271903 PA14_47990*,PA14_48000 +,-
Extrapolated Insert Location: 4271839 PA14_47990*,PA14_48000 +,-
Default Offset Location: 4271840 PA14_47990*,PA14_48000 +,-
PA14 BLAST Hit ID: 110249       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 6.64%
Query Start: 47 Query End: 66 Subject Start: 3918206 Subject End: 3918225 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3918206 PA14_44010 -
Raw Sequence Start: 3918123 PA14_44010 -
Extrapolated Insert Location: 3918187 PA14_44010 -
Default Offset Location: 3918186 PA14_44010 -
PAO1 BLAST Hit ID: 110250       Show Transposon Map
Identities: 130/131 (99.23%) BLAST Bit Score: 252.0 Percent of Processed Sequence That Aligns: 45.45%
Query Start: 27 Query End: 157 Subject Start: 1362755 Subject End: 1362885 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1362755 PA1254 -
Raw Sequence Start: 1362692 PA1254 -
Extrapolated Insert Location: 1362756 PA1254 -
Default Offset Location: 1362755 PA1254 -
PAO1 BLAST Hit ID: 110251       Show Transposon Map
Identities: 80/82 (97.56%) BLAST Bit Score: 147.0 Percent of Processed Sequence That Aligns: 28.32%
Query Start: 205 Query End: 286 Subject Start: 1362933 Subject End: 1363014 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1362933 PA1254 -
Raw Sequence Start: 1362692 PA1254 -
Extrapolated Insert Location: 1362756 PA1254 -
Default Offset Location: 1362755 PA1254 -
PAO1 BLAST Hit ID: 110252       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 6.64%
Query Start: 47 Query End: 66 Subject Start: 1725303 Subject End: 1725284 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1725303 PA1585 -
Raw Sequence Start: 1725386 PA1585 -
Extrapolated Insert Location: 1725322 PA1585 -
Default Offset Location: 1725323 PA1585 -
H PA14 Blast Hit H PAO1 Blast Hit