Mutant Report for Mutant ID: 44239

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 32608
Chromat Path: H:\Pa14\MrT7\461v1\461v1_G07_G7_054.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCATGC
GACCCCGCCCGGAATCGCCGTGCTGACCCAGGACAGCGATTGGGAGGTGCTCAACGAAGCCACCGGCTTC
TACGAGGAAAGCCCGTATCCCTCCGCCTTCAAGGGACAGGTGTATCGCGCGCTGAACTACATAAACGCTA
CGCCGACGGGCGCATCGCTGCTCTGGAACCTCTACACGACGAACAATTTCGTCGACATCACCCCCTCGTC
GCTGGGCAACAATGTCCAGTCCACCAATCAGCCCATGGCGCTCAATCAGGTCGCCAGAGAAATCATCGTA
GGAACCGGTCCCGGCCCCCAGACCCAGATCGCGCTCAATCAGACAGGCATCGCCCCGCAGGCGCAGACCC
AGGGGCTGACCTATGTCATCAACAGTTCGCCGCATTGGGCCCTGGACGGCGTGCCGGGCAACGGTGGTGC
CTTTACGGCTATCTAGAGCGCGCCCGCCAGTATGCAACCGCTGGATGCTGCTGTTCGACCACCGCTACTT
CCGCTGGAGCGACAGCAATGAAAGCTTATTTCAATGAGCAGAGCTTCAGGGGAAAATTTTCGGTATCTCC
GCCCCACAAAATCGCCATCACAAACCACGAAGTGGGCGGCCTGGCTTTGCCGGAAAACCGCTTCCCCACC
GGCTCAGGGATGCCCAGCAGAAACATGCGCGGCTTGCGACCATAATTGCCCTTAAGGACTTTCCGCCCCC
TTTGGGTGGGTTGTCCGCCCCTGGTAAAGGGAAACCCCACAGGGACCAAACCGGTGAACCGGGAAACTCC
CTCCGGCATCATTTGGGGGGGCTGTGCAAAGAAAATTTATCCGATTTAG
Blast against PA14
Processed Seqquence ID: 25099
5' Trim Position: 6 3' Trim Position: 472
Processed Sequence:
(Transposon Sequence in Red)
TTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCATGCGACCCC
GCCCGGAATCGCCGTGCTGACCCAGGACAGCGATTGGGAGGTGCTCAACGAAGCCACCGGCTTCTACGAG
GAAAGCCCGTATCCCTCCGCCTTCAAGGGACAGGTGTATCGCGCGCTGAACTACATAAACGCTACGCCGA
CGGGCGCATCGCTGCTCTGGAACCTCTACACGACGAACAATTTCGTCGACATCACCCCCTCGTCGCTGGG
CAACAATGTCCAGTCCACCAATCAGCCCATGGCGCTCAATCAGGTCGCCAGAGAAATCATCGTAGGAACC
GGTCCCGGCCCCCAGACCCAGATCGCGCTCAATCAGACAGGCATCGCCCCGCAGGCGCAGACCCAGGGGC
TGACCTATGTCATCAACAGTTCGCCGCATTGGGCCCTGGACGGCGT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
108653 108653
PA14 BLAST Hit ID: 108653       Show Transposon Map
Identities: 409/410 (99.75%) BLAST Bit Score: 805.0 Percent of Processed Sequence That Aligns: 87.77%
Query Start: 57 Query End: 466 Subject Start: 3020652 Subject End: 3020243 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3020652 PA14_33970 +
Raw Sequence Start: 3020714
Extrapolated Insert Location: 3020651 PA14_33970 +
Default Offset Location: 3020651 PA14_33970 +
H PA14 Blast Hit H PAO1 Blast Hit