Mutant Report for Mutant ID: 43337

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 27098
Chromat Path: H:\Pa14\MrT7\452v1\452v1_D05_D5_044.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATTGCAG
CTTGTCGCACTCGGCCGGGCTGAGCGTCTTGCGGAAGCGCAACTGGGCCAGCAGGATCATCGCCCAGGTC
CAGATCGCGCCGAAGGTGGCGATGGAGGTCACCCAGACGAACACCTTCTCCGGCACCAGGTAGTTCAGCA
ACACGCCCAGCAGCAGCGCCAGGATCGACAGGATCAGCGCCCGGCGCGGTACGCCGCTGCGCGAGGCCTT
GCCGAAGAAGGCCGGGGCCTGGCGATGCTGGGCCAGGCTGTAGAGCATGCGCCCGGTGCTGAAGATGCCG
CCGTTGCAGGACGACAGCGCGGCGGTGATCACCACGAAGTTGATGATCCCGGCGGCGGTCTTGATGCCCA
TACGCTCAAAGAACATCATCTGCAGGGCCTGGCCATNNNNNNNNTTTNTTTTCATCTGATTGTGTTTTTT
GATTCTCTAAAAGGAATTCTTATTTTTATATAAAAGGATGTCGCGAAACCATCGAGTTTTACTGCCGCCG
CGTAAGGTGACTATAGCTTCGAGTTCACCTCTCATTCTGCTTTGTGTATAGAGCCTATAACTTATTTCTT
CCTCAAGTTATGTACAACCACCAATAATGCTTTCGTAATGCCAGTCAGTGCACGTGCAGTGAAGCTGGAT
TTATGTTCGTTTGATTCTTCTTCCTTTATTTCATCGACTTCTACTTGTTCCCCCCGTTGTAAGTTTTCTG
TAATTTATTATAATATTTTTTCTTTTATTTCTTACATATATCCCCGCCCCTTCGTCTTTCTTGTTTGCTG
TTTCCGTATCTGCGTCTGCTACTTCATTGTCTCGAGAGCTCTTTTTTCCGCACCATCACCACTTATACTA
TATTTTACTAACCTCTCATCTCTTTCTCGTTCGCGTCTTATCTTTCTATTCCTTTTCCACTCACTCTTCT
TTATCTTTAGTTTA
Blast against PA14
Processed Seqquence ID: 20700
5' Trim Position: 3 3' Trim Position: 448
Processed Sequence:
(Transposon Sequence in Red)
TCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATTGCAGCTT
GTCGCACTCGGCCGGGCTGAGCGTCTTGCGGAAGCGCAACTGGGCCAGCAGGATCATCGCCCAGGTCCAG
ATCGCGCCGAAGGTGGCGATGGAGGTCACCCAGACGAACACCTTCTCCGGCACCAGGTAGTTCAGCAACA
CGCCCAGCAGCAGCGCCAGGATCGACAGGATCAGCGCCCGGCGCGGTACGCCGCTGCGCGAGGCCTTGCC
GAAGAAGGCCGGGGCCTGGCGATGCTGGGCCAGGCTGTAGAGCATGCGCCCGGTGCTGAAGATGCCGCCG
TTGCAGGACGACAGCGCGGCGGTGATCACCACGAAGTTGATGATCCCGGCGGCGGTCTTGATGCCCATAC
GCTCAAAGAACATCATCTGCAGGGC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
93337 93337 93338 93338 93339 93339 93340 93340 93341 93341 93342 93342 93343 93343
PA14 BLAST Hit ID: 93337       Show Transposon Map
Identities: 364/365 (99.72%) BLAST Bit Score: 716.0 Percent of Processed Sequence That Aligns: 81.80%
Query Start: 60 Query End: 424 Subject Start: 4792085 Subject End: 4792449 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4792085 PA14_54020*,PA14_54040 -,-
Raw Sequence Start: 4792023 PA14_54020*,PA14_54040 -,-
Extrapolated Insert Location: 4792086 PA14_54020*,PA14_54040 -,-
Default Offset Location: 4792086 PA14_54020*,PA14_54040 -,-
PA14 BLAST Hit ID: 93338       Show Transposon Map
Identities: 64/78 (82.05%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 17.30%
Query Start: 307 Query End: 384 Subject Start: 6011145 Subject End: 6011222 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6011145 PA14_67310,PA14_67290* -,+
Raw Sequence Start: 6010836 PA14_67310,PA14_67290* -,+
Extrapolated Insert Location: 6010899 PA14_67310,PA14_67290* -,+
Default Offset Location: 6010899 PA14_67310,PA14_67290* -,+
PA14 BLAST Hit ID: 93339       Show Transposon Map
Identities: 28/30 (93.33%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 6.52%
Query Start: 359 Query End: 388 Subject Start: 4703480 Subject End: 4703509 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4703480 PA14_53050 -
Raw Sequence Start: 4703119 PA14_53050 -
Extrapolated Insert Location: 4703182 PA14_53050 -
Default Offset Location: 4703182 PA14_53050 -
PAO1 BLAST Hit ID: 93340       Show Transposon Map
Identities: 360/365 (98.63%) BLAST Bit Score: 684.0 Percent of Processed Sequence That Aligns: 81.80%
Query Start: 60 Query End: 424 Subject Start: 865302 Subject End: 864938 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 865302 PA0789 -
Raw Sequence Start: 865364 PA0789 -
Extrapolated Insert Location: 865301 PA0789 -
Default Offset Location: 865301 PA0789 -
PAO1 BLAST Hit ID: 93341       Show Transposon Map
Identities: 64/78 (82.05%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 17.30%
Query Start: 307 Query End: 384 Subject Start: 5738886 Subject End: 5738963 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5738886 PA5097 -
Raw Sequence Start: 5738577 PA5097 -
Extrapolated Insert Location: 5738640 PA5097 -
Default Offset Location: 5738640 PA5097 -
PAO1 BLAST Hit ID: 93342       Show Transposon Map
Identities: 28/30 (93.33%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 6.52%
Query Start: 359 Query End: 388 Subject Start: 948125 Subject End: 948096 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 948125 PA0866 -
Raw Sequence Start: 948486 PA0866 -
Extrapolated Insert Location: 948423 PA0866 -
Default Offset Location: 948423 PA0866 -
PAO1 BLAST Hit ID: 93343       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.27%
Query Start: 138 Query End: 157 Subject Start: 3928030 Subject End: 3928011 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3928030 PA3512 +
Raw Sequence Start: 3928170 PA3512 +
Extrapolated Insert Location: 3928107 PA3512 +
Default Offset Location: 3928107 PA3512 +
H PA14 Blast Hit H PAO1 Blast Hit