Mutant Report for Mutant ID: 42462

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 26223
Chromat Path: H:\Pa14\MrT7\443v1\443v1_C06_C6_050.ab1 Last Transposon Base: Transposon Sequence
Match Quality:
Raw Sequence:
(Transposon Sequence in Red)
NNNNNNNTTTTNNNNNNNNNNNNNNNNNNNTTGGGTTNNNGGGGGCGGNNNNNTNTCNNNCCTTGTTCAG
TTTGCAAAACGACAGGTATCATCTGCTGGAGTCCGGACAATTATCAGCCAACCTGTTAGTCCTCGTCCAG
GCTCATGGCCTGGTCCGCGCGCTTCTCGCGGACCCGCGCGACGCCCACCGCGGCGTATTCGCCGAGGCCG
ACGCGCTCGGTCAGCATGCGGAACGCCTGGCTGCCCAGGGCCACCGGCGCGCGGCTCTCGAAGGCGGCAT
TGTCGTCGCGCACTTCCTGCACCTGGCTGACGTAGTGGGCGCCGTCGAGGGCCTCGCCCTCCTCTACCGT
GTCCCGGGTGTTGACTCTCTTCTTCAGAAGGACGGGGTGGACAATAACGCTCTCTTGTCCCCTCTTGTCC
TCCCGATGTTTACTTTCCCCGTTGCCCATTTACACCTACTTTTTTTGGTCCTCTGGCTTCGTCCCCATGG
ACTCCCCCCCCTGCTTTGTCCGCCTCTTTTCCCAGCTACCCTGTCTTCTCTACCTTTTATCCCCTTTTTC
TCGTGCATCTTCCTCCTTACTAATGAACTGTCTATCTTTTTGACCCCTATTCGCTCCTTATTACCCCTTT
TGTCTTGCTTTACCTTTCGCCTGATACTTGACCCCACCACGCCTCGGCCCACCATGGGGCGGCGTATTAT
ACCCTTTACTCTATTCCCCTATTTTGTATGCTACAAATTAAATCTCCGATATGGTTTCGTTAATTTTTTA
TCATTTTAACCTCTGCCAACCTATCCTAATATCCCTCACTCTCCCCGCGCCTTCACTTATTTTGTATTTT
GATCTCGTTTTTCTGCCTCGCGCGCCCCCCCCCGCCCGTCCCCGCCCTCTCCGCCCCCCCTATTTTATAC
TTTTTTTATCCTCTCCCTGCTATAGCCCTTTTTTTCTTCTTCTTGTTTTTAATTCTATTATCACCCTCGA
CATTATCGCCGAATCTCCC
Blast against PA14
Processed Seqquence ID: 20068
5' Trim Position: 110 3' Trim Position: 352
Processed Sequence:
(Transposon Sequence in Red)
TTATCAGCCAACCTGTTAGTCCTCGTCCAGGCTCATGGCCTGGTCCGCGCGCTTCTCGCGGACCCGCGCG
ACGCCCACCGCGGCGTATTCGCCGAGGCCGACGCGCTCGGTCAGCATGCGGAACGCCTGGCTGCCCAGGG
CCACCGGCGCGCGGCTCTCGAAGGCGGCATTGTCGTCGCGCACTTCCTGCACCTGGCTGACGTAGTGGGC
GCCGTCGAGGGCCTCGCCCTCCTCTACCGTGT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
90985 90985 90986 90986
PA14 BLAST Hit ID: 90985       Show Transposon Map
Identities: 221/226 (97.78%) BLAST Bit Score: 408.0 Percent of Processed Sequence That Aligns: 92.98%
Query Start: 17 Query End: 242 Subject Start: 94830 Subject End: 95055 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 94830 PA14_00940,PA14_00950* -,+
Raw Sequence Start: 94704 PA14_00940,PA14_00950* -,+
Extrapolated Insert Location:
Default Offset Location: 94767 PA14_00940,PA14_00950* -,+
PAO1 BLAST Hit ID: 90986       Show Transposon Map
Identities: 220/226 (97.34%) BLAST Bit Score: 400.0 Percent of Processed Sequence That Aligns: 92.98%
Query Start: 17 Query End: 242 Subject Start: 97182 Subject End: 97407 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 97182 PA0079 -
Raw Sequence Start: 97056 PA0079 -
Extrapolated Insert Location:
Default Offset Location: 97119 PA0079 -
H PA14 Blast Hit H PAO1 Blast Hit