Mutant Report for Mutant ID: 42362

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 26123
Chromat Path: H:\Pa14\MrT7\442v1\442v1_C02_C2_017.ab1 Last Transposon Base: 62 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATAGGACG
CCACTGCAAGACCTCATCGGCGCATCATCTTCCGGGGTGCGCACGAGCGCGCCTCGATTGTTGTGTCCGC
CGCGCTGCAAGCAAGTTGCAGGCCGCTGCCGAGCGTCGCGGCGCTGGCCGCGACGACGATTGCCCGCCTG
CACGATAACCCAGCACGACGCACTTTGCCGGGGCACGCCTGGCCAGCTTTTTCTTATGTCCCGAGGACAT
TTTTAATAATTTTCCTTCGCCGCGGCTTGCGCGACCATCCTTCCCCATCGACCCCATGGACAGCGGTCCG
CCTCCCGGCGGTCCGGGCCATGCGTGCAGAACCACGACCGGCGCAGACCGGCGAGATAACAAGGAGAAGG
TGGGGTGTTCGAACTCAGCGATTGGCAACGGCGCGCCGCGACACAGCGCTTCATCGACCAGGCCCTGATC
GGCGGCCGCCAGCGTACGGCCGCCAGCGGCGCTTCCTTCGACGCCATCGATCCTGCGAAGAATTCTCTGT
TGGCTCGGGTCCCGGCCCTGTTATTGCGGCCGACATCTACGCGGCAGTGGTCTGCTGCCTGCGCGCCTTC
AAACAAGGCCCCTGGCCGCCTCTCGCCCCGGGCGAAGGCAAACCCTGTGTTGTTGCCCTTGGCCCAACTT
GTGCTTGGCCATCCCGAAAAGTTGTCCTTCTCCATTTCTTTAAATGGCAAGCCGTTATGTACCCCGGAAT
TTTTTGTGCCGGCGCCCCCACGTTTTTCCCTGGTTTGCGGAAACCCCCAAAGCTTTTAGACTGGGTTCTC
CAACCCCACACAGTCCGGTCTCCATTTCCCCTTGTCCTGGTGGGGATTTGTCCGGGTGGCCCTTAAAC
Blast against PA14
Processed Seqquence ID: 19980
5' Trim Position: 4 3' Trim Position: 434
Processed Sequence:
(Transposon Sequence in Red)
GTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATAGGACGCCAC
TGCAAGACCTCATCGGCGCATCATCTTCCGGGGTGCGCACGAGCGCGCCTCGATTGTTGTGTCCGCCGCG
CTGCAAGCAAGTTGCAGGCCGCTGCCGAGCGTCGCGGCGCTGGCCGCGACGACGATTGCCCGCCTGCACG
ATAACCCAGCACGACGCACTTTGCCGGGGCACGCCTGGCCAGCTTTTTCTTATGTCCCGAGGACATTTTT
AATAATTTTCCTTCGCCGCGGCTTGCGCGACCATCCTTCCCCATCGACCCCATGGACAGCGGTCCGCCTC
CCGGCGGTCCGGGCCATGCGTGCAGAACCACGACCGGCGCAGACCGGCGAGATAACAAGGAGAAGGTGGG
GTGTTCGAAC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
90621 90621 90622 90622
PA14 BLAST Hit ID: 90621       Show Transposon Map
Identities: 365/373 (97.85%) BLAST Bit Score: 676.0 Percent of Processed Sequence That Aligns: 86.51%
Query Start: 58 Query End: 430 Subject Start: 237007 Subject End: 237379 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 237007 PA14_02660 -
Raw Sequence Start: 236946 PA14_02660 -
Extrapolated Insert Location: 237008 PA14_02660 -
Default Offset Location: 237009 PA14_02660 -
PAO1 BLAST Hit ID: 90622       Show Transposon Map
Identities: 364/373 (97.58%) BLAST Bit Score: 668.0 Percent of Processed Sequence That Aligns: 86.51%
Query Start: 58 Query End: 430 Subject Start: 246856 Subject End: 247228 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 246856 PA0218 -
Raw Sequence Start: 246795 PA0218 -
Extrapolated Insert Location: 246857 PA0218 -
Default Offset Location: 246858 PA0218 -
H PA14 Blast Hit H PAO1 Blast Hit