Mutant Report for Mutant ID: 42090

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 25851
Chromat Path: H:\Pa14\MrT7\439v1\439v1_D06_D6_058.ab1 Last Transposon Base: 64 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATTCGC
GGAACGCGCGCATCCTCGGCGCTCTGCGTTCAGGTGTCGCGGCGCCAGGCCAGGCCGACGCTCATCGACG
GCACCGGGTCGACCAGCGATAGCGTCTCGATGCGTTTGCCTTCCATCGTCTGGGGGCGGGGCAACAGATC
GGAGAGGATGGCCACGCCGGAGCCGTTGGCGACCATGCTGCGCACCGCTTCCACCGAACTGGTATGGAGG
ATCACCTGCGGCCGGTGGCCGCTCTGTTGCCAGTAGCGCAGCGCGCTCTGCCCGGCCTCGTCGACGGTGA
GCATGATGTAGGGCTCGCCGGCCACGTCGGCCAGGCCCAGGTCGGCCTTCTCACCCAGCGGATGGCGGCT
GGGCAGCCACAACCGGCGCTCGGAGTTGAACAGGGTTTCGGCGGCGATCCCGGGCTCGGTGAGATTGCCG
GTGAGCAGCACGGCGATGTCGTAGCGACCGTCGAGGAGGCCGCGCTCGATGCTGGCGCGCTCGTCCTCAA
ACAGTTGCAGCTCCAGGTCCGGATACCCCTACTACCCATCATCTGAGGGGCTGGGCCAAGAAAATCTTCT
TTCCTCTTATAGTTGGGTGGTGATCTTAATGTGGTGATTTAATCTGGTTTATTGTTATACGTGTATTCGA
ATCAGTATATAACCCTTAATTTTAATTATAATAGCATGTTTTAGATAGATCCCACTCCCCTTCGACTTTC
GTATCTTGCTCTCGTTCTTGCGTGCAAAAAAGGTCTCCCATTAATGTCCCCACCCATTCTTCTAGCTCAG
ACCAACTAACTAAACCAATATCATTCTTTCTCTTTTATACTCCGCTCATCTGCTAAAACACTGGTTGTAA
TTTCTATATACTCCGCAATTTAATTATTATTACCCT
Blast against PA14
Processed Seqquence ID: 19731
5' Trim Position: 2 3' Trim Position: 561
Processed Sequence:
(Transposon Sequence in Red)
TTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATTCGCGG
AACGCGCGCATCCTCGGCGCTCTGCGTTCAGGTGTCGCGGCGCCAGGCCAGGCCGACGCTCATCGACGGC
ACCGGGTCGACCAGCGATAGCGTCTCGATGCGTTTGCCTTCCATCGTCTGGGGGCGGGGCAACAGATCGG
AGAGGATGGCCACGCCGGAGCCGTTGGCGACCATGCTGCGCACCGCTTCCACCGAACTGGTATGGAGGAT
CACCTGCGGCCGGTGGCCGCTCTGTTGCCAGTAGCGCAGCGCGCTCTGCCCGGCCTCGTCGACGGTGAGC
ATGATGTAGGGCTCGCCGGCCACGTCGGCCAGGCCCAGGTCGGCCTTCTCACCCAGCGGATGGCGGCTGG
GCAGCCACAACCGGCGCTCGGAGTTGAACAGGGTTTCGGCGGCGATCCCGGGCTCGGTGAGATTGCCGGT
GAGCAGCACGGCGATGTCGTAGCGACCGTCGAGGAGGCCGCGCTCGATGCTGGCGCGCTCGTCCTCAAA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
89621 89621 89622 89622 89623 89623 89624 89624
PA14 BLAST Hit ID: 89621       Show Transposon Map
Identities: 483/495 (97.57%) BLAST Bit Score: 854.0 Percent of Processed Sequence That Aligns: 88.37%
Query Start: 62 Query End: 556 Subject Start: 563704 Subject End: 564194 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 563704 PA14_06370*,PA14_06400 +,-
Raw Sequence Start: 563641 PA14_06370* +
Extrapolated Insert Location: 563705 PA14_06370*,PA14_06400 +,-
Default Offset Location: 563704 PA14_06370*,PA14_06400 +,-
PA14 BLAST Hit ID: 89622       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.11%
Query Start: 377 Query End: 400 Subject Start: 6266021 Subject End: 6265998 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6266021 PA14_70270,PA14_70250* -,+
Raw Sequence Start: 6266399 PA14_70270,PA14_70250* -,+
Extrapolated Insert Location: 6266335 PA14_70270,PA14_70250* -,+
Default Offset Location: 6266336 PA14_70270,PA14_70250* -,+
PAO1 BLAST Hit ID: 89623       Show Transposon Map
Identities: 479/495 (96.76%) BLAST Bit Score: 823.0 Percent of Processed Sequence That Aligns: 88.37%
Query Start: 62 Query End: 556 Subject Start: 550916 Subject End: 551406 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 550916 PA0491 -
Raw Sequence Start: 550853
Extrapolated Insert Location: 550917 PA0491 -
Default Offset Location: 550916 PA0491 -
PAO1 BLAST Hit ID: 89624       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.11%
Query Start: 377 Query End: 400 Subject Start: 5993101 Subject End: 5993078 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5993101 PA5322 -
Raw Sequence Start: 5993479 PA5322 -
Extrapolated Insert Location: 5993415 PA5322 -
Default Offset Location: 5993416 PA5322 -
H PA14 Blast Hit H PAO1 Blast Hit