Mutant Report for Mutant ID: 42033

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 25794
Chromat Path: H:\Pa14\MrT7\438v1\438v1_G09_G9_072.ab1 Last Transposon Base: 120 Transposon Sequence
Match Quality: 4
Raw Sequence:
(Transposon Sequence in Red)
NNNNNNNNNNNNNNNNNNCCCCNNNNNNNNNGGGGNNNNNNNNGGGNNNNAACCNNNTTGTTCAGTTTGT
ATACGACTCACTATAGGGGTCTAGAGACCGGAGGCTTATCAGCCAACCTGTTACGCGGTCCTTGTCGGTC
TTTTTCTGCCCGGCCTCGTCGGCGTGGGCTGCCTGCGGTGCGGCGATGGCGGTGATGGCGACACCGATGG
CAGAAGCCAGCAGACGTTGCGAAGAAACGGCGGTATCCGTGGACTGACGCGACATTCGAAACCCCTCCCC
GTGAGCTGTGAAGGTCGCGGAATTTATTGCAGATCAGAATTGTTATCAATTATTACGGATTCGCATTCGA
CAGGAATTTACATTCTTTACAATTTTCTCATTACATTTTTTCCCATCTCGCTCGTCTACACCCTCTGTGG
GTTTTGGCATGGTCAATGCTATTCGGTGTCGTGTGGGTATGATTTTAACCACATTTACACGTTAAAATGG
TTCATATGTGGCACATTTGTTGGTGACAGGAATGCTACCGTACACCGGGGAATGAGCAATTTTGAAGCAT
GTGTGTTGTGCCTTTTTTTCATCATCGATCCGTTCGTGTCTTCCTTTCATATATCTTATACATATCGACA
AGTTTCGGTTACACTTTTGACTCCACATACACAACCTGTTTAACCTGTGCGAAAATTCTCGTTGTCTTTC
TTTCTTTCCTGTTGTCTTTTCGTTTCTCCGTACTGGCCGAAGTATATAACGCAGGAGGCAAAATGGGTTT
TCAAAGTTACAAATGCGCGTCTTGGGGGTTTTTCGTTTATTTTAGTGCTGAGAGTCTTATAATTCGCTTC
ATTGTAATTCAATCTTCTTAGATTGTTTTGTTGTTCCTATGTGTGTAAACACCCGCTTGTTGTGCCTCAG
GATTTGACACATCATGTGTGGTACACATCAAAAGTTTAGTCCACTCCTCTTGTCGCGCTCCGTGTTTCTC
CGATGTTTTATATG
Blast against PA14
Processed Seqquence ID: 19677
5' Trim Position: 76 3' Trim Position: 408
Processed Sequence:
(Transposon Sequence in Red)
CTCACTATAGGGGTCTAGAGACCGGAGGCTTATCAGCCAACCTGTTACGCGGTCCTTGTCGGTCTTTTTC
TGCCCGGCCTCGTCGGCGTGGGCTGCCTGCGGTGCGGCGATGGCGGTGATGGCGACACCGATGGCAGAAG
CCAGCAGACGTTGCGAAGAAACGGCGGTATCCGTGGACTGACGCGACATTCGAAACCCCTCCCCGTGAGC
TGTGAAGGTCGCGGAATTTATTGCAGATCAGAATTGTTATCAATTATTACGGATTCGCATTCGACAGGAA
TTTACATTCTTTACAATTTTCTCATTACATTTTTTCCCATCTCGCTCGTCTA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
89373 89373 89374 89374
PA14 BLAST Hit ID: 89373       Show Transposon Map
Identities: 286/287 (99.65%) BLAST Bit Score: 561.0 Percent of Processed Sequence That Aligns: 86.14%
Query Start: 46 Query End: 332 Subject Start: 5219440 Subject End: 5219726 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5219440 PA14_58570 -
Raw Sequence Start: 5219319 PA14_58570 -
Extrapolated Insert Location: 5219439 PA14_58570 -
Default Offset Location: 5219382 PA14_58570 -
PAO1 BLAST Hit ID: 89374       Show Transposon Map
Identities: 285/287 (99.30%) BLAST Bit Score: 553.0 Percent of Processed Sequence That Aligns: 86.14%
Query Start: 46 Query End: 332 Subject Start: 5055733 Subject End: 5056019 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5055733 PA4514 -
Raw Sequence Start: 5055612 PA4514 -
Extrapolated Insert Location: 5055732 PA4514 -
Default Offset Location: 5055675 PA4514 -
H PA14 Blast Hit H PAO1 Blast Hit