Mutant Report for Mutant ID: 41935

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 25696
Chromat Path: H:\Pa14\MrT7\437v1\437v1_G07_G7_054.ab1 Last Transposon Base: 61 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTATACGACTACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATTCGATCC
AGCGCAGCGTCGACGACGCGCTCAACAGCCCGCAACCGGACACCCGGGTCGACGGCACCCTGAAGGTCGC
CGCCAGCTATACCGTGATGGGCTATTTCCTCCCCCATCATCTGCAGGCCTGGCCAAANNNNNNNNNANAA
CTGNANNTGNANNTGNNNGAAGGAAGAGAGTAGAGGATGGAGTGGGGTCTCTTCTATTGTTGATACGACA
TCTGCGCGCTGCTCACCGGAAATCTCATTTAGCTTGTTTTCGTCGACAAAGATGTGCTCAACTCCGAGTG
ACTTTTGGAGGGGTGTCTATACGTTTTATGATGGGGGATAAGGCCGAGCTGTGGCCGGAGCGATGTGTAC
CGCAAGGCATATATCTTTCTCGCCTGTCCAATATACGTTCACCACGCACCCCGCCTTTGCTTCAAAACTC
CCTACGTCCCAGGATTATCGATCTGTTTTAATGTATGGCCGTGTGTTTATATGATAATTAACATTCACTA
TTATAAAACAGTTTATTTTGGTAGTGTTTAGTTTTTTGGTTGGTTGAATTATGATACCTTATGAGTCGTC
CGATTTTGGTGAATCCGGCCTGGCGGATTTGTGACCCCCACATATATGTCATATTTTCCAACTCAAGAAT
GATACACCAAATTTCTTTATTATTGAATAATTTTATCCGTATCCAACATTTTTATTATATTAGTCAGAAG
CTCTATACATATAACCGTATATGTCATCTTCAAGTGTTATTATATCATTATCCCATTTCCATAATCATAT
CCATTTTT
Blast against PA14
Processed Seqquence ID: 19597
5' Trim Position: 1 3' Trim Position: 198
Processed Sequence:
(Transposon Sequence in Red)
GTCGTTTGTATACGACTACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATTCGATCCA
GCGCAGCGTCGACGACGCGCTCAACAGCCCGCAACCGGACACCCGGGTCGACGGCACCCTGAAGGTCGCC
GCCAGCTATACCGTGATGGGCTATTTCCTCCCCCATCATCTGCAGGCCTGGCCAAAN
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
89027 89027 89028 89028
PA14 BLAST Hit ID: 89027       Show Transposon Map
Identities: 123/125 (98.40%) BLAST Bit Score: 232.0 Percent of Processed Sequence That Aligns: 62.94%
Query Start: 60 Query End: 184 Subject Start: 564362 Subject End: 564238 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 564362 PA14_06400 +
Raw Sequence Start: 564422 PA14_06400 +
Extrapolated Insert Location: 564361 PA14_06400 +
Default Offset Location: 564359 PA14_06400 +
PAO1 BLAST Hit ID: 89028       Show Transposon Map
Identities: 122/125 (97.60%) BLAST Bit Score: 224.0 Percent of Processed Sequence That Aligns: 62.94%
Query Start: 60 Query End: 184 Subject Start: 551574 Subject End: 551450 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 551574 PA0491 +
Raw Sequence Start: 551634 PA0491 +
Extrapolated Insert Location: 551573 PA0491 +
Default Offset Location: 551571 PA0491 +
H PA14 Blast Hit H PAO1 Blast Hit