Mutant Report for Mutant ID: 41544

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 25305
Chromat Path: H:\Pa14\MrT7\433v1\433v1_F12_F12_101.ab1 Last Transposon Base: 59 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
CCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGACTACGGC
TGGTTCACCGGCTCGCTGCTCGGCGGCGCGCTCTACTACGGCCTCTGCGGCCGCCGTGCGCGGAGCCCGG
CGGCATTGGCCAAACCGCTGCCCTGATGGGCATACAGGCGGCCGGCGAGCCGCCGACACCTACTCCAAGC
CTGAGGAGACGACAATGAGCACTGCCCGGAACGTCCTGCAATACACCCAACAAACATCATCTGGAGGGCC
TGGCCAAANNNNNNNTNNTNNNNTNTNNNNNNNNTNNNNNNNNNNNNNNANNNNGNNNNTNTGNNNNNTG
NTNNTTATTTTTTTTTTATTGTNTTGGNNNNAATTTTNTTNNTGTATTGTTTGNTAATTGGTTTTGTTGN
NTGGTTAGTGTTTGATTGGGGTTGGTAAAATTTTTTGTTTGGTNGTTNGGTGGTGTAATGTGGGAATTGT
TNNTGTGTGATGATAGAGTAGATATATTGATATTAAGAAAAGAGGTGGTAAGTTTGAAGGTTTGATTAGG
GGTGATAGGAAGGAATATAGGTGATAAGAANATTAAAAGAGATAGGGGAGGAAATTGAGGNGTAGTTTAG
AGGTGGTGGTGTGTTAAAATTAGAAAAGGTTCGGGTTTCGTGACTTGGAATGATGGGTTAGGGATTATTT
CGTTGGGAAGTTAACCCTGGTAAGAAACCCTGGCCCAACGCGAATGTCGAAAGTGGTATTCTTAAGGAAG
GTCGCTTGACGTCATTTGGTTACGCCGGGACGGGTTGATTGGTCTCGAAAATCGGGGGGGGCGCTATTTC
CGAGGGCAAATTCGAAAGGGGTTCAACCCTCG
Blast against PA14
Processed Seqquence ID: 19252
5' Trim Position: 9 3' Trim Position: 271
Processed Sequence:
(Transposon Sequence in Red)
TACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGACTACGGCTGGTTCACC
GGCTCGCTGCTCGGCGGCGCGCTCTACTACGGCCTCTGCGGCCGCCGTGCGCGGAGCCCGGCGGCATTGG
CCAAACCGCTGCCCTGATGGGCATACAGGCGGCCGGCGAGCCGCCGACACCTACTCCAAGCCTGAGGAGA
CGACAATGAGCACTGCCCGGAACGTCCTGCAATACACCCAACAAACATCATC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
87343 87343 87344 87344 87345 87345 87346 87346
PA14 BLAST Hit ID: 87343       Show Transposon Map
Identities: 200/201 (99.50%) BLAST Bit Score: 391.0 Percent of Processed Sequence That Aligns: 76.34%
Query Start: 50 Query End: 250 Subject Start: 513005 Subject End: 513205 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 513005 PA14_05780*,PA14_05790 -,+
Raw Sequence Start: 512947 PA14_05780*,PA14_05790 -,+
Extrapolated Insert Location: 513006 PA14_05780*,PA14_05790 -,+
Default Offset Location: 513010 PA14_05780*,PA14_05790 -,+
PA14 BLAST Hit ID: 87344       Show Transposon Map
Identities: 22/22 (100.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 8.02%
Query Start: 71 Query End: 92 Subject Start: 3307112 Subject End: 3307091 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3307112 PA14_37110*,PA14_37100 -,+
Raw Sequence Start: 3307191 PA14_37110* -
Extrapolated Insert Location: 3307132 PA14_37110*,PA14_37100 -,+
Default Offset Location: 3307128 PA14_37110*,PA14_37100 -,+
PAO1 BLAST Hit ID: 87345       Show Transposon Map
Identities: 200/201 (99.50%) BLAST Bit Score: 391.0 Percent of Processed Sequence That Aligns: 76.34%
Query Start: 50 Query End: 250 Subject Start: 498254 Subject End: 498454 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 498254 PA0443 +
Raw Sequence Start: 498196 PA0443 +
Extrapolated Insert Location: 498255 PA0443 +
Default Offset Location: 498259 PA0443 +
PAO1 BLAST Hit ID: 87346       Show Transposon Map
Identities: 22/22 (100.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 8.02%
Query Start: 71 Query End: 92 Subject Start: 2336284 Subject End: 2336305 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2336284 PA2124 +
Raw Sequence Start: 2336205
Extrapolated Insert Location: 2336264 PA2124 +
Default Offset Location: 2336268 PA2124 +
H PA14 Blast Hit H PAO1 Blast Hit