Mutant Report for Mutant ID: 41380

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 25141
Chromat Path: H:\Pa14\MrT7\432v1\432v1_A04_A4_024.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTAGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATACCAT
CGGCGCGCATCATCTGCAGGCCTGGCCAGGCTANCTGGNGGAAATGACCGTGGCCCACGCCACCCCCGGC
TCGTTCGGCGCCTTCGCCGAGCACTACGTCGGCCCGCTGGCCGGGTTCCTGGTGCGCTACGCCTATTGGG
CGGCCATCGTCCTGGCGGTGGGCACCGAGGTCACGGCGGTGGCCATGTACATGAAGTACTGGTTCGCCGG
TATCCCGGAATGGGTCTGGATCATCTCCTTCTCGACCCTGCTGATCGGCCTGAACGCCAGCAGCGTGAAA
GCCTTCGGCAACTTCGAATACTGCTTCTCGACACCGTATATCGACGTGGTCATGTGTCGATTTAGCGAGG
GTGATTGTGTGAAATGATGAAGACAGCGAGGGCGGACGGGGGGGAAAGGGGCTGCAAGGGATCAGAGGAT
CAGAGTAAGAAAAACGGGAGTAAGGCTTGCCACTTCATTAAATTTTTTACAGTGACACACTCTTGTTATT
TTCTATTTTAGTGTTTTGGTTCTTCGGTTTTATTCTAAGCTTGATCTTTGTATATGTGTAATTAACAACA
ATATAACTTCCCTCTTTTCTCTCTTTCTCACTCACTATTCATTTTTCTTTCTATTTCCCACATATTTGTT
TCATGCTTTCTAATCTACATCCGCTTTTTTTATAATTTTGACATCCGTGGCTTTCCCATTATAACACCAA
CCGGTCAATGACTATGAGTTAGACTCGTTAGCCACCTCACTAGGACAATAAGGTGCGAACAGCCCCGGTA
AGATGGGTCTTATTATCATAATAAGACAACATTATTTATATAATACAAAAAAAACGTTGAAAACATGCCG
AGCCTTTACACACCAGAAAAAATCGTAG
Blast against PA14
Processed Seqquence ID: 19100
5' Trim Position: 13 3' Trim Position: 364
Processed Sequence:
(Transposon Sequence in Red)
TACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATACCATCGGCGCGCATCAT
CTGCAGGCCTGGCCAGGCTANCTGGNGGAAATGACCGTGGCCCACGCCACCCCCGGCTCGTTCGGCGCCT
TCGCCGAGCACTACGTCGGCCCGCTGGCCGGGTTCCTGGTGCGCTACGCCTATTGGGCGGCCATCGTCCT
GGCGGTGGGCACCGAGGTCACGGCGGTGGCCATGTACATGAAGTACTGGTTCGCCGGTATCCCGGAATGG
GTCTGGATCATCTCCTTCTCGACCCTGCTGATCGGCCTGAACGCCAGCAGCGTGAAAGCCTTCGGCAACT
T
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
86703 86703 86704 86704
PA14 BLAST Hit ID: 86703       Show Transposon Map
Identities: 259/260 (99.61%) BLAST Bit Score: 509.0 Percent of Processed Sequence That Aligns: 73.79%
Query Start: 92 Query End: 351 Subject Start: 3347670 Subject End: 3347929 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3347670 PA14_37630,PA14_37620* +,-
Raw Sequence Start: 3347566 PA14_37630,PA14_37620* +,-
Extrapolated Insert Location: 3347629 PA14_37630,PA14_37620* +,-
Default Offset Location: 3347629 PA14_37630,PA14_37620* +,-
PAO1 BLAST Hit ID: 86704       Show Transposon Map
Identities: 257/260 (98.84%) BLAST Bit Score: 494.0 Percent of Processed Sequence That Aligns: 73.79%
Query Start: 92 Query End: 351 Subject Start: 2288716 Subject End: 2288457 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2288716 PA2079 +
Raw Sequence Start: 2288820 PA2079 +
Extrapolated Insert Location: 2288757 PA2079 +
Default Offset Location: 2288757 PA2079 +
H PA14 Blast Hit H PAO1 Blast Hit