Mutant Report for Mutant ID: 41295

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 25056
Chromat Path: H:\Pa14\MrT7\431v1\431v1_B03_B3_028.ab1 Last Transposon Base: 62 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACAGCAAC
GAAGAACGCCGCAAGCGCATCTTCGCCATCGTCGGCGCCTCCTCCGGCAACCTCGTGGAATGGTTCGACT
TCTACGTCTACGCCTTCTGCGCGATCTACTTCGCACCGGCCTTCTTCCCCTCCGACAACCCCACGGTGCA
GTTGCTGAACACCGCCGGGGTCTTCGCCGCCGGCTTCCTCATGCGCCCCATCGGCGGCTGGATGTTCGGC
CGCATCGCCGACAAGCACGGGCGCAAGACCGCCATGCTGATCTCGGTGGTGATGATGTGCGCCGGCTCCC
TGGCGATCGCCTGCATACCCACCTACACCATCATCTGAAGGGGCCTGGGCCAGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNGNNNNNNNNNNNNNNNNNNCN
NGNNNNNGNGNNGGGNGGGNGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG
GGGGGGGGGGGGGGGGGNGGGGGGGGGGGGNGGGGGGGGGGGGGGGGGGGGGGGNGGGNGGGGGGGGGGG
GGGGGGGGGNNGGNGGNNGGGGGGGGGGGNGNGGGGGGGNGNGGGGGGGGGGGAGAANTTGGNGGGGGGG
GTGTANGNNGGGN
Blast against PA14
Processed Seqquence ID: 19022
5' Trim Position: 8 3' Trim Position: 390
Processed Sequence:
(Transposon Sequence in Red)
TGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACAGCAACGAAGAACG
CCGCAAGCGCATCTTCGCCATCGTCGGCGCCTCCTCCGGCAACCTCGTGGAATGGTTCGACTTCTACGTC
TACGCCTTCTGCGCGATCTACTTCGCACCGGCCTTCTTCCCCTCCGACAACCCCACGGTGCAGTTGCTGA
ACACCGCCGGGGTCTTCGCCGCCGGCTTCCTCATGCGCCCCATCGGCGGCTGGATGTTCGGCCGCATCGC
CGACAAGCACGGGCGCAAGACCGCCATGCTGATCTCGGTGGTGATGATGTGCGCCGGCTCCCTGGCGATC
GCCTGCATACCCACCTACACCATCATCTGAAG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
86338 86338 86339 86339 86340 86340 86341 86341 86342 86342 86343 86343 86344 86344 86345 86345 86346 86346 86347 86347
PA14 BLAST Hit ID: 86338       Show Transposon Map
Identities: 321/324 (99.07%) BLAST Bit Score: 618.0 Percent of Processed Sequence That Aligns: 84.55%
Query Start: 54 Query End: 377 Subject Start: 248635 Subject End: 248958 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 248635 PA14_02800*,PA14_02810 +,+
Raw Sequence Start: 248574 PA14_02780* -
Extrapolated Insert Location: 248636 PA14_02800*,PA14_02810 +,+
Default Offset Location: 248637 PA14_02800*,PA14_02810 +,+
PA14 BLAST Hit ID: 86339       Show Transposon Map
Identities: 50/59 (84.74%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 15.18%
Query Start: 205 Query End: 263 Subject Start: 6496593 Subject End: 6496651 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6496593 PA14_72960,PA14_72950* +,-
Raw Sequence Start: 6496381 PA14_72950* -
Extrapolated Insert Location: 6496443 PA14_72960,PA14_72950* +,-
Default Offset Location: 6496444 PA14_72960,PA14_72950* +,-
PA14 BLAST Hit ID: 86340       Show Transposon Map
Identities: 47/53 (88.67%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 13.35%
Query Start: 224 Query End: 275 Subject Start: 1403962 Subject End: 1404013 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1403962 PA14_16400*,PA14_16410 -,+
Raw Sequence Start: 1403731 PA14_16400* -
Extrapolated Insert Location: 1403793 PA14_16400*,PA14_16410 -,+
Default Offset Location: 1403794 PA14_16400*,PA14_16410 -,+
PA14 BLAST Hit ID: 86341       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.97%
Query Start: 85 Query End: 104 Subject Start: 3000357 Subject End: 3000338 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3000357 PA14_33760 +
Raw Sequence Start: 3000449 PA14_33760 +
Extrapolated Insert Location: 3000387 PA14_33760 +
Default Offset Location: 3000386 PA14_33760 +
PA14 BLAST Hit ID: 86342       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.97%
Query Start: 223 Query End: 242 Subject Start: 533600 Subject End: 533581 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 533600 PA14_06000 -
Raw Sequence Start: 533830 PA14_06010 -
Extrapolated Insert Location: 533768 PA14_06010 -
Default Offset Location: 533767 PA14_06010 -
PAO1 BLAST Hit ID: 86343       Show Transposon Map
Identities: 321/324 (99.07%) BLAST Bit Score: 618.0 Percent of Processed Sequence That Aligns: 84.55%
Query Start: 54 Query End: 377 Subject Start: 258484 Subject End: 258807 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 258484 PA0229 +
Raw Sequence Start: 258423
Extrapolated Insert Location: 258485 PA0229 +
Default Offset Location: 258486 PA0229 +
PAO1 BLAST Hit ID: 86344       Show Transposon Map
Identities: 50/59 (84.74%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 15.18%
Query Start: 205 Query End: 263 Subject Start: 6223354 Subject End: 6223412 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6223354 PA5530 +
Raw Sequence Start: 6223142
Extrapolated Insert Location: 6223204 PA5530 +
Default Offset Location: 6223205 PA5530 +
PAO1 BLAST Hit ID: 86345       Show Transposon Map
Identities: 47/53 (88.67%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 13.35%
Query Start: 224 Query End: 275 Subject Start: 4154026 Subject End: 4153975 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4154026 PA3709 +
Raw Sequence Start: 4154257
Extrapolated Insert Location: 4154195 PA3709 +
Default Offset Location: 4154194 PA3709 +
PAO1 BLAST Hit ID: 86346       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.97%
Query Start: 85 Query End: 104 Subject Start: 2643436 Subject End: 2643455 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2643436 PA2390 +
Raw Sequence Start: 2643344 PA2390 +
Extrapolated Insert Location: 2643406 PA2390 +
Default Offset Location: 2643407 PA2390 +
PAO1 BLAST Hit ID: 86347       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.97%
Query Start: 223 Query End: 242 Subject Start: 520588 Subject End: 520569 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 520588 PA0459 -
Raw Sequence Start: 520818 PA0460 -
Extrapolated Insert Location: 520756 PA0460 -
Default Offset Location: 520755 PA0460 -
H PA14 Blast Hit H PAO1 Blast Hit