Mutant Report for Mutant ID: 41049

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 24810
Chromat Path: H:\Pa14\MrT7\428v1\428v1_E09_E9_071.ab1 Last Transposon Base: 65 Transposon Sequence
Match Quality: 2
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTAGTAAACGAATAGGCATCATCTGCTGGAGTACCGGACACTTATCAGCCAACCTGTTAGGCC
AGCACCGCGCCGGCCGGGCCGCCCTGGTTGATGGTCACGCCGGAGCCCATGAACAGCCCGGTGCCGATCA
CCCCGCCGAGGGACAGCATGAAGATGTGGCGGCTCGCCAGGGCCCGGGTGAGTTGCAGCCTTTCCTTGCC
GTCAGCCATGGCGCACCTCCGGATGAGGATACGCGCATGCGCCATCATCTGCAGGCCTGGCCACAGTCCT
TCCAGAGTCGCAATGCGATCGCTGCAATCTAATAACGCTTTTTGGTCTCCTTAATGTACTATGCACCTCG
AGTTCACCCATAAATTCTGTATCAACCATTCATAGAATTTTTCGTCTGCTCCAAGCAAGGAGACAATGTA
TTGGTTTGAGATAGTATATCAGTGTGTGGTATGACATTAAGCAGGCAAGACACAAACGACCAAAGTAACC
GTACCAAGTACCCAGTTACTTCCTAGTTATCATACCAGAACAATGCGTTTAAAACACTTTCCAGTACTCG
TAATAGTACCCCATAATACAATGTGTGAGTAATTAATAGACCTAATACGTGATAAGTAGGACAACCTACA
TTCATGACCCCATGTTCCTATACTATAAAAACATTATTATGGTTCAGCTTCCTCTTAGAGTTTACACATA
TAATCACCTATGCACCCTCATAAAAAATATTCGAATACCCACCATACTAGACGAATAAGGAAAAACCCTC
GCATTCGCCGAGACAAACTAAAATCAGATAAAACAACAGGACAGGGCACACACAGTGTGTTACCATAGTT
ACATATGTCATAACGCATGTACCAGCACATCATAATGTGGTACGCTCAGAACAACTTCACAGAAATCACA
AAATTAATCATCACTAAAGCGACACACAGTCCCGAAGGAATAACATAGAATAGAACAGCACAAATAAN
Blast against PA14
Processed Seqquence ID: 18797
5' Trim Position: 41 3' Trim Position: 275
Processed Sequence:
(Transposon Sequence in Red)
CGGACACTTATCAGCCAACCTGTTAGGCCAGCACCGCGCCGGCCGGGCCGCCCTGGTTGATGGTCACGCC
GGAGCCCATGAACAGCCCGGTGCCGATCACCCCGCCGAGGGACAGCATGAAGATGTGGCGGCTCGCCAGG
GCCCGGGTGAGTTGCAGCCTTTCCTTGCCGTCAGCCATGGCGCACCTCCGGATGAGGATACGCGCATGCG
CCATCATCTGCAGGCCTGGCCACA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
85407 85407 85408 85408 85409 85409 85410 85410 85411 85411 85412 85412 85413 85413 85414 85414 85415 85415 85416 85416
PA14 BLAST Hit ID: 85407       Show Transposon Map
Identities: 182/183 (99.45%) BLAST Bit Score: 355.0 Percent of Processed Sequence That Aligns: 77.78%
Query Start: 24 Query End: 206 Subject Start: 5866338 Subject End: 5866520 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5866338 PA14_65850 -
Raw Sequence Start: 5866274 PA14_65850 -
Extrapolated Insert Location: 5866339 PA14_65850 -
Default Offset Location: 5866337 PA14_65850 -
PA14 BLAST Hit ID: 85408       Show Transposon Map
Identities: 45/52 (86.53%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 21.79%
Query Start: 68 Query End: 119 Subject Start: 145174 Subject End: 145225 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 145174 PA14_01570*,PA14_01580 -,-
Raw Sequence Start: 145066 PA14_01570*,PA14_01580 -,-
Extrapolated Insert Location: 145131 PA14_01570*,PA14_01580 -,-
Default Offset Location: 145129 PA14_01570*,PA14_01580 -,-
PA14 BLAST Hit ID: 85409       Show Transposon Map
Identities: 26/27 (96.29%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 11.11%
Query Start: 80 Query End: 106 Subject Start: 2210278 Subject End: 2210252 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2210278 PA14_25260*,PA14_25270 +,-
Raw Sequence Start: 2210398 PA14_25260*,PA14_25270 +,-
Extrapolated Insert Location: 2210333 PA14_25260*,PA14_25270 +,-
Default Offset Location: 2210335 PA14_25260*,PA14_25270 +,-
PA14 BLAST Hit ID: 85410       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 8.12%
Query Start: 27 Query End: 46 Subject Start: 6133975 Subject End: 6133994 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6133975 PA14_68780 -
Raw Sequence Start: 6133908
Extrapolated Insert Location: 6133973 PA14_68780 -
Default Offset Location: 6133971 PA14_68780 -
PA14 BLAST Hit ID: 85411       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 9.83%
Query Start: 74 Query End: 97 Subject Start: 3347582 Subject End: 3347559 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3347582 PA14_37630,PA14_37620* -,+
Raw Sequence Start: 3347696 PA14_37630,PA14_37620* -,+
Extrapolated Insert Location: 3347631 PA14_37630,PA14_37620* -,+
Default Offset Location: 3347633 PA14_37630,PA14_37620* -,+
PAO1 BLAST Hit ID: 85412       Show Transposon Map
Identities: 181/183 (98.90%) BLAST Bit Score: 347.0 Percent of Processed Sequence That Aligns: 77.78%
Query Start: 24 Query End: 206 Subject Start: 5594940 Subject End: 5595122 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5594940 PA4981 -
Raw Sequence Start: 5594876 PA4981 -
Extrapolated Insert Location: 5594941 PA4981 -
Default Offset Location: 5594939 PA4981 -
PAO1 BLAST Hit ID: 85413       Show Transposon Map
Identities: 45/52 (86.53%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 21.79%
Query Start: 68 Query End: 119 Subject Start: 147258 Subject End: 147309 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 147258 PA0129 -
Raw Sequence Start: 147150 PA0129 -
Extrapolated Insert Location: 147215 PA0129 -
Default Offset Location: 147213 PA0129 -
PAO1 BLAST Hit ID: 85414       Show Transposon Map
Identities: 26/27 (96.29%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 11.11%
Query Start: 80 Query End: 106 Subject Start: 3359065 Subject End: 3359091 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3359065 PA3000 -
Raw Sequence Start: 3358945 PA3000 -
Extrapolated Insert Location: 3359010 PA3000 -
Default Offset Location: 3359008 PA3000 -
PAO1 BLAST Hit ID: 85415       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 8.12%
Query Start: 27 Query End: 46 Subject Start: 5861763 Subject End: 5861782 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5861763 PA5207 -
Raw Sequence Start: 5861696
Extrapolated Insert Location: 5861761 PA5207 -
Default Offset Location: 5861759 PA5207 -
PAO1 BLAST Hit ID: 85416       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 9.83%
Query Start: 74 Query End: 97 Subject Start: 2288804 Subject End: 2288827 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2288804 PA2079 -
Raw Sequence Start: 2288690 PA2079 -
Extrapolated Insert Location: 2288755 PA2079 -
Default Offset Location: 2288753 PA2079 -
H PA14 Blast Hit H PAO1 Blast Hit