Mutant Report for Mutant ID: 40876

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 24637
Chromat Path: H:\Pa14\MrT7\426v1\426v1_G04_G4_034.ab1 Last Transposon Base: 64 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
GTTCAGTTTGTATACGACTACACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACTGAT
CGGCCTGGCGCTGCTCTCCCCTGTCCATGCGGCGGACTACCTGGCCGGACTGCCGCCGCCGCAACCCGCT
CCGTCCGGCGGCGGCAACGTCCTCTACTACCTGGAACTGGTGATCAACGGCCGCGACAGCGGCCAGGTGG
TGCCGGTCAACGCCGCCGATGGCCATTACCTGCTCGACGCCGCGGCCCTGCGCGAAGCCGGCGTGCGCCT
GCCTGGCAACCCCGCCGGACAGGTCGCGGTGGACGCCCTGCCCGAGGTCCGGGCGGACTATGACAGCGCC
AGCCAGCAACTGCACCTGCAAGTGCCGCCGGACTGGCTGCCGGAGCAGCGCTTCGACGATCCCGGACTGG
TCGCCCGCGCCCCGGCGCGCAGCAGCCTCGGCGCGCTGTTCAACTACGACCTGTACTACTCGGCCCCCGC
CGACGGCGCCACACCCTGGCTTTCCGCGCTGCTCGAGCAACGTCTGTTCGACGGCTTTCGGGGTGATCTC
CAACACCGGGCGTCTACACCCGGCTATTTTCGGCGACCCCTAACTACCTTCGACAGCCGCTTACCTGGCG
CTATGAACACCTAACTGGGCTGTACCAACAAACGAAACGGCAAAAATGCACAAGCTTCCCATCTTGGGGC
GAACTACCTCCAACGGGCGCTGTTTAAATTGGAACCATCCCGGGTTACGCATGGGGGCGGGTTTTCTGCT
TTGCCCCCCAAACCTTCGGGGGTACCTTCCCGAACCTGGTCCCCCCATACCCGTTCTGGTGCTTTCTAAC
GGCCAAGGCCCGCGATAACCCAAGAACCGTCTGAAATTGTTCTATCAAATGTTTAAAAAGAGCCTAAAGA
GTGCCCAAATGTTTACCCCGGTCCCCTTTCCCCTATCGAAACCGGGCCGTATN
Blast against PA14
Processed Seqquence ID: 18633
5' Trim Position: 21 3' Trim Position: 540
Processed Sequence:
(Transposon Sequence in Red)
ACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACTGATCGGCCTGGCGCTGCTCTCCCC
TGTCCATGCGGCGGACTACCTGGCCGGACTGCCGCCGCCGCAACCCGCTCCGTCCGGCGGCGGCAACGTC
CTCTACTACCTGGAACTGGTGATCAACGGCCGCGACAGCGGCCAGGTGGTGCCGGTCAACGCCGCCGATG
GCCATTACCTGCTCGACGCCGCGGCCCTGCGCGAAGCCGGCGTGCGCCTGCCTGGCAACCCCGCCGGACA
GGTCGCGGTGGACGCCCTGCCCGAGGTCCGGGCGGACTATGACAGCGCCAGCCAGCAACTGCACCTGCAA
GTGCCGCCGGACTGGCTGCCGGAGCAGCGCTTCGACGATCCCGGACTGGTCGCCCGCGCCCCGGCGCGCA
GCAGCCTCGGCGCGCTGTTCAACTACGACCTGTACTACTCGGCCCCCGCCGACGGCGCCACACCCTGGCT
TTCCGCGCTGCTCGAGCAACGTCTGTTCG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
84670 84670 84671 84671 84672 84672 84673 84673 84674 84674
PA14 BLAST Hit ID: 84670       Show Transposon Map
Identities: 477/477 (100.00%) BLAST Bit Score: 946.0 Percent of Processed Sequence That Aligns: 91.71%
Query Start: 43 Query End: 519 Subject Start: 5489552 Subject End: 5490028 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5489552 PA14_61540 +
Raw Sequence Start: 5489489 PA14_61530 +
Extrapolated Insert Location: 5489553 PA14_61540 +
Default Offset Location: 5489552 PA14_61540 +
PA14 BLAST Hit ID: 84671       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.85%
Query Start: 360 Query End: 380 Subject Start: 168473 Subject End: 168493 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 168473 PA14_01840 +
Raw Sequence Start: 168093 PA14_01820* -
Extrapolated Insert Location: 168157 PA14_01820* -
Default Offset Location: 168156 PA14_01820* -
PA14 BLAST Hit ID: 84672       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.66%
Query Start: 231 Query End: 250 Subject Start: 5776283 Subject End: 5776302 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5776283 PA14_64810 +
Raw Sequence Start: 5776032 PA14_64810 +
Extrapolated Insert Location: 5776096 PA14_64810 +
Default Offset Location: 5776095 PA14_64810 +
PAO1 BLAST Hit ID: 84673       Show Transposon Map
Identities: 473/477 (99.16%) BLAST Bit Score: 914.0 Percent of Processed Sequence That Aligns: 91.71%
Query Start: 43 Query End: 519 Subject Start: 5217611 Subject End: 5218087 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5217611 PA4652 +
Raw Sequence Start: 5217548 PA4651 +
Extrapolated Insert Location: 5217612 PA4652 +
Default Offset Location: 5217611 PA4652 +
PAO1 BLAST Hit ID: 84674       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.66%
Query Start: 231 Query End: 250 Subject Start: 5504876 Subject End: 5504895 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5504876 PA4905 +
Raw Sequence Start: 5504625 PA4905 +
Extrapolated Insert Location: 5504689 PA4905 +
Default Offset Location: 5504688 PA4905 +
H PA14 Blast Hit H PAO1 Blast Hit