Mutant Report for Mutant ID: 40799

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 24560
Chromat Path: H:\Pa14\MrT7\425v1\425v1_H11_H11_094.ab1 Last Transposon Base: 60 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTATCGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACCCGTTCAA
CCAGTTGCTGATCCTGTTCCTGGGTTAGCATGAAAGCTCCTCTTCGAACCTGGAGGAGCTTCGAGCGTCC
CAGCGAATCGTCTTGCCAAGATAGACTCGGGCTTCTTGCAAAAGTTCTCCCCTCCAAGCATGCGTCACGA
GTTTTTTCCTCGCTCGTGACGTGCGGCCCCGGACATCGTGTCCGGGCCCCGCGAAAATGGATTGCATCGG
GCTCAGGGCCCGGCCTCTGTGCCGCTGGGTAGGCCAACCGGACGAGGTCTTCAGGCATCCTGCTTTGGAA
CCGATGCGTCTAAGAAAGTTCCAGCACTACATCGCCCCGCTCTGATGACGCCTGCCGATGACAGGCCCGC
AGCTCATCCGCCGGACCGGCAGCGGGGGTGCGCTATTGTGCCGCCAGGCCCTTCTATATACTAGGGCTCC
ACCTCATCGAAATGGCGTGGACAAGCCAACATTATCAACACGATGTACTGGTCATCGGCAGCGGCGCCGC
CGGCCTGAGTCTGGCCTTGACCCTTCCGGAACACCTGCGCATCGCCGTCCTCAGCAAGGGCGAACTGTCG
CAGGGCTCGACTTACTGGGCCCAGGGCGGCGTGGCCGCCGTGCTGGACGATACCGACACCGTGGAATCCC
CGTTCGAGGACACACTGGTCGCCGGTGGCGGCCTGTGCCGCGAGGACGCGGTGCGCTTCACCGTGGAGCA
TAGCCGCGAAGCGATCCAGTGGCTGATCGAACAGGGGGTGCCCTTCACCCGCGACGAGGAGCACACCACG
AGGAA
Blast against PA14
Processed Seqquence ID: 18562
5' Trim Position: 10 3' Trim Position: 696
Processed Sequence:
(Transposon Sequence in Red)
ATCGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACCCGTTCAACCAGTTGCTG
ATCCTGTTCCTGGGTTAGCATGAAAGCTCCTCTTCGAACCTGGAGGAGCTTCGAGCGTCCCAGCGAATCG
TCTTGCCAAGATAGACTCGGGCTTCTTGCAAAAGTTCTCCCCTCCAAGCATGCGTCACGAGTTTTTTCCT
CGCTCGTGACGTGCGGCCCCGGACATCGTGTCCGGGCCCCGCGAAAATGGATTGCATCGGGCTCAGGGCC
CGGCCTCTGTGCCGCTGGGTAGGCCAACCGGACGAGGTCTTCAGGCATCCTGCTTTGGAACCGATGCGTC
TAAGAAAGTTCCAGCACTACATCGCCCCGCTCTGATGACGCCTGCCGATGACAGGCCCGCAGCTCATCCG
CCGGACCGGCAGCGGGGGTGCGCTATTGTGCCGCCAGGCCCTTCTATATACTAGGGCTCCACCTCATCGA
AATGGCGTGGACAAGCCAACATTATCAACACGATGTACTGGTCATCGGCAGCGGCGCCGCCGGCCTGAGT
CTGGCCTTGACCCTTCCGGAACACCTGCGCATCGCCGTCCTCAGCAAGGGCGAACTGTCGCAGGGCTCGA
CTTACTGGGCCCAGGGCGGCGTGGCCGCCGTGCTGGACGATACCGACACCGTGGAA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
84368 84368 84369 84369
PA14 BLAST Hit ID: 84368       Show Transposon Map
Identities: 628/637 (98.58%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 92.71%
Query Start: 50 Query End: 686 Subject Start: 4826612 Subject End: 4827247 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4826612 PA14_54430 -
Raw Sequence Start: 4826553 PA14_54430 -
Extrapolated Insert Location: 4826613 PA14_54430 -
Default Offset Location: 4826616 PA14_54430 -
PAO1 BLAST Hit ID: 84369       Show Transposon Map
Identities: 627/637 (98.43%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 92.71%
Query Start: 50 Query End: 686 Subject Start: 831342 Subject End: 830707 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 831342 PA0762 -
Raw Sequence Start: 831401 PA0762 -
Extrapolated Insert Location: 831341 PA0762 -
Default Offset Location: 831338 PA0762 -
H PA14 Blast Hit H PAO1 Blast Hit