Mutant Report for Mutant ID: 40478

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 24239
Chromat Path: H:\Pa14\MrT7\422v1\422v1_F02_F2_016.ab1 Last Transposon Base: 61 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACATCAACA
AGACCGCGGCCCACGGCGAATGGCTGGACCGCAACGGCAACCGGCTGGACAAGTCCGGCACCAAGGAAGG
CGGGCAGTTCGTCAATGCCACCACCAACCTGCCGGAGATGTGGTGCCCAGGTTTCAACGGCAAGCTGTTC
GGTTTCATCTCGCTGGACTGGTTCGGCGGCACCATGACCCATCCGCTGTTTTCGGCGGCAGGGCGCAAGT
ACATGGTCCTTGCGGCCATGCGCCTGGCCATGTTGATCAAGATCATCCGCAAGCGTTACCCGGACGACAC
CATCAATGTCGTCGGGCACAGCCAGGGCACCCTGTTGACCCTGCTGGCACATGCCTTCCTCAAGGATGAC
GGCGTGGCGCCGGCGGACGGGGTGATCATGCTCAACTCACCCTACGGCCTGTTCGAACCCCTCAACGAGA
AGCTCCAGGGCTGGAGCAGCCAGCAGACCAGAGAGGCGCGGCTGGCCACGCTCAAAGGCATCCTCGAGTT
CATCTGCGGCCGGCGCCATCCGGTCCCCGCGCTGAACAGCGTCGCGTTGCGCAACTGCCAAGGCTACGGC
GCGATAGGCGGTCCCGGCTGGGTGGGTGGCCTGGGCTGCCAAACGACCATCGACGGGGAACGGCTCCACT
TCGATGAGCGCGACCATCCCCGGCAGTGTCTTACCTGTATTTCACGCCCCAGGACCAAGAAGGTGGGAAC
TTGCCAACGTCCCGGGGTATTGGGCTTGGGGCGGCTTTTCTTGAACAAGGCAAAGGGGCTCCCCGGGAAA
GAAACCGGCTTGCCCCAGGGTTTTTCCCCAAGGGATTCTTCACCCGTACGCAAGGCGCAATGGGCGAATA
G
Blast against PA14
Processed Seqquence ID: 18329
5' Trim Position: 2 3' Trim Position: 591
Processed Sequence:
(Transposon Sequence in Red)
TCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACATCAACAAG
ACCGCGGCCCACGGCGAATGGCTGGACCGCAACGGCAACCGGCTGGACAAGTCCGGCACCAAGGAAGGCG
GGCAGTTCGTCAATGCCACCACCAACCTGCCGGAGATGTGGTGCCCAGGTTTCAACGGCAAGCTGTTCGG
TTTCATCTCGCTGGACTGGTTCGGCGGCACCATGACCCATCCGCTGTTTTCGGCGGCAGGGCGCAAGTAC
ATGGTCCTTGCGGCCATGCGCCTGGCCATGTTGATCAAGATCATCCGCAAGCGTTACCCGGACGACACCA
TCAATGTCGTCGGGCACAGCCAGGGCACCCTGTTGACCCTGCTGGCACATGCCTTCCTCAAGGATGACGG
CGTGGCGCCGGCGGACGGGGTGATCATGCTCAACTCACCCTACGGCCTGTTCGAACCCCTCAACGAGAAG
CTCCAGGGCTGGAGCAGCCAGCAGACCAGAGAGGCGCGGCTGGCCACGCTCAAAGGCATCCTCGAGTTCA
TCTGCGGCCGGCGCCATCCGGTCCCCGCG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
83435 83435 83436 83436
PA14 BLAST Hit ID: 83435       Show Transposon Map
Identities: 527/531 (99.24%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 89.98%
Query Start: 59 Query End: 589 Subject Start: 284319 Subject End: 283789 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 284319 PA14_03200 +
Raw Sequence Start: 284379 PA14_03200 +
Extrapolated Insert Location: 284318 PA14_03200 +
Default Offset Location: 284316 PA14_03200 +
PAO1 BLAST Hit ID: 83436       Show Transposon Map
Identities: 525/531 (98.87%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 89.98%
Query Start: 59 Query End: 589 Subject Start: 292908 Subject End: 292378 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 292908 PA0260 +
Raw Sequence Start: 292968 PA0260 +
Extrapolated Insert Location: 292907 PA0260 +
Default Offset Location: 292905 PA0260 +
H PA14 Blast Hit H PAO1 Blast Hit