Mutant Report for Mutant ID: 40270

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 24031
Chromat Path: H:\Pa14\MrT7\420v1\420v1_D10_D10_090.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATGCCTA
TGGCATGCAACTGGATGTGGCTCGCGTTATATCTTCAACCGACACTTCCAATGCCTGCGGCATCGTTCCC
GCACGCATGACCTACGAAGATTCGAACGGGCAGAAACATACCGTCGAATACCATCATCTGCAGGCCTGGG
CAGGCCTGGCCAANNNTCTNNNNNACCTCCGGGTCNACCTCCNAAGGATCGCGCCACGNGGGGCAGCTCG
CCCATCCGGCGCGATCATTGTGTACTCGGCGGCGAAAATACCGCCCCTCGGCGACATCTGTGGGCCTGGC
CAGCGCACCTCTACATGATGCCTACCTATAATTGGGGTATGAGGCTTAGGCCGTTTCGTCGAGGAATCAG
CAAAAGCGGGGAAGCTCGCCAATCGAACCTAGATTTGTAGAAAAGAAGGCGGTAATATCTTATGACCCTC
TAATGACAACCCGACGGCGAAAACGGTCAACTACTGAAGAATGTGCTTATTTTATAAGAGTTGCAAAATA
TCTTGAACATGTAAAAAAGCGATTTCGTAATAGCGGAATCTTATTTAATAATGTAAGAAGTTAGACCGCT
TACCTTATTTTGCAACACGAAGAAATGTTTCTCACACAGATTGTACCGATATATTACACAAATGTACCGG
TGTAATATTATACGTTACAAATCACAGTCCCTTACGACTAGCTGCAAAAGTTACATTCGGTTAATACATG
CCAAACATTGAAATATGTGTTCTTTCCTATATTTAATATCAATATTACATCATTACCTAGACTTCCATAC
TATAATAGACGATACGATATGCGGGACGGGCACAACATGCGTCCTACTGAAACCCTA
Blast against PA14
Processed Seqquence ID: 18132
5' Trim Position: 3 3' Trim Position: 335
Processed Sequence:
(Transposon Sequence in Red)
CAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATGCCTATGG
CATGCAACTGGATGTGGCTCGCGTTATATCTTCAACCGACACTTCCAATGCCTGCGGCATCGTTCCCGCA
CGCATGACCTACGAAGATTCGAACGGGCAGAAACATACCGTCGAATACCATCATCTGCAGGCCTGGGCAG
GCCTGGCCAANNNTCTNNNNNACCTCCGGGTCNACCTCCNAAGGATCGCGCCACGNGGGGCAGCTCGCCC
ATCCGGCGCGATCATTGTGTACTCGGCGGCGAAAATACCGCCCCTCGGCGAC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
82425 82425 82426 82426 82427 82427 82428 82428
PA14 BLAST Hit ID: 82425       Show Transposon Map
Identities: 128/128 (100.00%) BLAST Bit Score: 254.0 Percent of Processed Sequence That Aligns: 38.25%
Query Start: 60 Query End: 187 Subject Start: 4695974 Subject End: 4696101 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4695974 PA14_52960 +
Raw Sequence Start: 4695912 PA14_52960 +
Extrapolated Insert Location: 4695975 PA14_52960 +
Default Offset Location: 4695975 PA14_52960 +
PA14 BLAST Hit ID: 82426       Show Transposon Map
Identities: 96/100 (96.00%) BLAST Bit Score: 172.0 Percent of Processed Sequence That Aligns: 29.82%
Query Start: 232 Query End: 331 Subject Start: 4696146 Subject End: 4696245 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4696146
Raw Sequence Start: 4695912 PA14_52960 +
Extrapolated Insert Location: 4695975 PA14_52960 +
Default Offset Location: 4695975 PA14_52960 +
PAO1 BLAST Hit ID: 82427       Show Transposon Map
Identities: 127/128 (99.21%) BLAST Bit Score: 246.0 Percent of Processed Sequence That Aligns: 38.25%
Query Start: 60 Query End: 187 Subject Start: 955617 Subject End: 955490 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 955617 PA0874 +
Raw Sequence Start: 955679 PA0874 +
Extrapolated Insert Location: 955616 PA0874 +
Default Offset Location: 955616 PA0874 +
PAO1 BLAST Hit ID: 82428       Show Transposon Map
Identities: 84/88 (95.45%) BLAST Bit Score: 147.0 Percent of Processed Sequence That Aligns: 26.20%
Query Start: 244 Query End: 331 Subject Start: 955445 Subject End: 955358 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 955445
Raw Sequence Start: 955691 PA0874 +
Extrapolated Insert Location: 955628 PA0874 +
Default Offset Location: 955628 PA0874 +
H PA14 Blast Hit H PAO1 Blast Hit