Mutant Report for Mutant ID: 39201

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_04_04
Raw Sequence ID: 22962
Chromat Path: H:\Pa14\MrT7\409v1\409v1_C09_C9_070.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATAGAGC
AGCCCCAGCCCGGTGTCGGTCAGGCCGATGCCTTGCAGGCCGGCGTCCACCAGCCCGCCGTTGCGCAGCA
GCAGGATCCAGGCGTAGACCCGCACCAGCAGGTTGGTCCAGAACGGCACGGTGACCAGGAACAGCAGCAG
GTTGCGCCGGCGTTCCGGCTGCAACGCCAGGTACAGCGCGGTGGGGAAGCCGAGTGCCAGGCAGCCGAGG
GTGGTCAGCAGCGACAGCCAGAACGAGCGCTGGAAGATGCCCAGGTAGTCGGCGTTGAACACCAGGCTGT
CGTCCAGGTCGCGTTCCCAGAGGAAATTGAGGTAGGCCTCCAGGCTGTGCTGGCCCCACTTCACCCCGCC
GTAGTCGCCGGACTGCTGGATCGACACGGCGAACATGATGCCTAGCGGGATCACCAGGAACAGCACCATC
ATCTGCATTGCCGGACATGTCAAAATCATGGGTCAACTCAAATATCGGCATTGGTCTTCAGAAGTGCAAA
ATGTCAGTCTGTGGCTTTAATCAGCGAGAACTATGTAGGGGAAGCAGGAACCATCCCTTGGCCTTCAACC
CTAAATGAGAAGTATAACTATGAAAAAACGGTTTAGTTGATGAATAAAAAACCCTGGTGGCCGGTAAAAA
ATGGAGGTAAAAGATACGGGTGCTACATAGACAGATTTATCAGGAAAGGTTACAATGTGTCGCATGGCTC
TATAATATTGTCCTCCAAACGGGTCGTAAAGAATAACGAAAACATTGTCCCGGTATATACATTTACCAGA
CTGTTTGAGTAAAACGAGAGAAAAAACAACGGGGATCGATAAAATCCATTGTAAAAAA
Blast against PA14
Processed Seqquence ID: 17140
5' Trim Position: 4 3' Trim Position: 493
Processed Sequence:
(Transposon Sequence in Red)
CAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATAGAGCAGCC
CCAGCCCGGTGTCGGTCAGGCCGATGCCTTGCAGGCCGGCGTCCACCAGCCCGCCGTTGCGCAGCAGCAG
GATCCAGGCGTAGACCCGCACCAGCAGGTTGGTCCAGAACGGCACGGTGACCAGGAACAGCAGCAGGTTG
CGCCGGCGTTCCGGCTGCAACGCCAGGTACAGCGCGGTGGGGAAGCCGAGTGCCAGGCAGCCGAGGGTGG
TCAGCAGCGACAGCCAGAACGAGCGCTGGAAGATGCCCAGGTAGTCGGCGTTGAACACCAGGCTGTCGTC
CAGGTCGCGTTCCCAGAGGAAATTGAGGTAGGCCTCCAGGCTGTGCTGGCCCCACTTCACCCCGCCGTAG
TCGCCGGACTGCTGGATCGACACGGCGAACATGATGCCTAGCGGGATCACCAGGAACAGCACCATCATC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
77600 77600 77601 77601 77602 77602 77603 77603 77604 77604 77605 77605 77606 77606 77607 77607
PA14 BLAST Hit ID: 77600       Show Transposon Map
Identities: 430/431 (99.76%) BLAST Bit Score: 846.0 Percent of Processed Sequence That Aligns: 87.93%
Query Start: 59 Query End: 489 Subject Start: 379734 Subject End: 380164 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 379734 PA14_04240 -
Raw Sequence Start: 379672 PA14_04240 -
Extrapolated Insert Location: 379735 PA14_04240 -
Default Offset Location: 379735 PA14_04240 -
PA14 BLAST Hit ID: 77601       Show Transposon Map
Identities: 63/73 (86.30%) BLAST Bit Score: 65.9 Percent of Processed Sequence That Aligns: 14.72%
Query Start: 142 Query End: 214 Subject Start: 1515440 Subject End: 1515512 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1515440 PA14_17630 -
Raw Sequence Start: 1515295 PA14_17630 -
Extrapolated Insert Location: 1515358 PA14_17630 -
Default Offset Location: 1515358 PA14_17630 -
PA14 BLAST Hit ID: 77602       Show Transposon Map
Identities: 32/35 (91.42%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 6.95%
Query Start: 101 Query End: 135 Subject Start: 3131962 Subject End: 3131996 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3131962 PA14_35210 -
Raw Sequence Start: 3131858 PA14_35200 -
Extrapolated Insert Location: 3131921 PA14_35210 -
Default Offset Location: 3131921 PA14_35210 -
PA14 BLAST Hit ID: 77603       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.89%
Query Start: 194 Query End: 213 Subject Start: 594593 Subject End: 594574 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 594593 PA14_06840 -
Raw Sequence Start: 594790 PA14_06840 -
Extrapolated Insert Location: 594727 PA14_06840 -
Default Offset Location: 594727 PA14_06840 -
PAO1 BLAST Hit ID: 77604       Show Transposon Map
Identities: 425/431 (98.60%) BLAST Bit Score: 807.0 Percent of Processed Sequence That Aligns: 87.93%
Query Start: 59 Query End: 489 Subject Start: 365564 Subject End: 365994 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 365564 PA0325 -
Raw Sequence Start: 365502 PA0325 -
Extrapolated Insert Location: 365565 PA0325 -
Default Offset Location: 365565 PA0325 -
PAO1 BLAST Hit ID: 77605       Show Transposon Map
Identities: 68/79 (86.07%) BLAST Bit Score: 69.9 Percent of Processed Sequence That Aligns: 15.95%
Query Start: 129 Query End: 207 Subject Start: 234409 Subject End: 234487 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 234409 PA0205 -
Raw Sequence Start: 234277 PA0205 -
Extrapolated Insert Location: 234340 PA0205 -
Default Offset Location: 234340 PA0205 -
PAO1 BLAST Hit ID: 77606       Show Transposon Map
Identities: 63/73 (86.30%) BLAST Bit Score: 65.9 Percent of Processed Sequence That Aligns: 14.72%
Query Start: 142 Query End: 214 Subject Start: 4042568 Subject End: 4042496 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4042568 PA3608 -
Raw Sequence Start: 4042713 PA3608 -
Extrapolated Insert Location: 4042650 PA3608 -
Default Offset Location: 4042650 PA3608 -
PAO1 BLAST Hit ID: 77607       Show Transposon Map
Identities: 32/35 (91.42%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 6.95%
Query Start: 101 Query End: 135 Subject Start: 2500986 Subject End: 2500952 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2500986 PA2270 -
Raw Sequence Start: 2501090 PA2271 -
Extrapolated Insert Location: 2501027 PA2270 -
Default Offset Location: 2501027 PA2270 -
H PA14 Blast Hit H PAO1 Blast Hit